Description :
From Genome Similarity Track
Location :
Scaffold_38:62928- 75260
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_38-snap-gene-0.36Dynein heavy chain

Sequence
12332 bases(100 bases per row)
ACGTGTCGAGCATGCAGAGCATGGCGCAGCCTCGCCGGATCCAGTGGTCGGGCTCGCGGTCCGTCGGCACATCAAGCGCGACGACAAAGTTGGTCGAGTG
GCCGGTAGTGGATAGCGTGCCGGCTCGTAGCGAAGTCTTGTAAAGCGGACATTCGTACACGTCCTCGGGTTTGTACTCTTCGCGCTTCATGGGCTTGAGC
CAGATGACGGGCATGCGGTCGAAGAGCTCGCCGGGGATCGACTCGGCCATCAGCCGCGCGTTGCGGTCGAATCTTGCGCCTTCCATGAAGAGTCCGAAGA
TGTAGACGCCGAACGGTGGCGGCGCCGAGAACCCTTCCTTGTCTCTTCCCAATACCTCGCTGGCCACGACCAACGCGTCGATCGCCAGTTTCTGGTCGCG
AGCGAAAGCCTGCTTGACGGCCGTCATGAATCCCTGCGGGAAGAAGAACCCCGAGATCCAGAACGCTTTCGGCGGACCTTGAGTGAGCCAGTCGCGCGCA
AACGAAAGGCGAGCGAACAGATCCTCCGTCCAGCTTGCTAGTGGTTTGAGACACGGGTAACCTGCATCCTCCCACTCGCGCGGCACCTGCTGCAGCAAAA
AGCCGTGGTACATGCGCTCGAGCGGGCCGGACATGACGACGAGTCCTTGAATGGCGCGCGCCAGCGAGTCGAGTGTCGCCTTGAGCACCTTCAACAGGAC
ATTGAAGCGAATGAGCTCTTGCGATAGAAACACACCAAGTGAGTTGCGACTTCCGCCTGCCGCAGCGAACGTTGCTGGGTGTGCCGAGCTCTCAGCGAAC
AGCTCCGGCAGGCGCGCTTGGATGGACGCCACGATGTCCATGACGACGGCATCGTCACTGGGTGCTGAGGCGCCTCCACCCCCTTCGCCACCGCCACCGC
CGCCCAGCATCCTCAACACCGTTCCCAGTAGTTGTCCTGCCTCCTTCTGCTGGAACGTGATGTCGGCGTTGGCGTGTAACCCAAACAAGTCTGGGGCGTC
GACCTGTGGAAGCGAGCCCACGTACTCGCGAACATTCACAAGGCTTCCTTCAGACGGCGCGAAATACGCCCCCGACGCCGTGAATTTGTACGCGTCATCG
AGAACGGCGGGACAGAACAGAGGACGCATGATACTCGCGTTCGTGCGCTTGTCCCATCGGTCCGTGATGCGACCGCCGTACGAAATGTCGGCCACCATGA
CGTTGAGCGTCACGAACGGCACCGTGTCTTGCTCCTCAAGGTACAGCCGCACCTGCTGCATTCCCGTCTTGAGGTCGCTGTTCATCCACTCGTACGGGAT
GTTCCACCCGACGGCGCCGAACTTGCGCCTCTCGAGGCACACGGCGTTGTAGAAGGCCAGCGCGAACAGCAGCTTCTTGAACGCGCGAGGCTTGGCGCAA
CCTTCATAGTCGGCCTCTTTCATATCCAGGAAGGTACGGCCAAGGTTTGCCTTGATACCTCGGGGAGGTTCGTTCGTGATCTTGATCCCGTTCTGCAGGA
TCGGCACAGGGAACCGCGGGCTTGGCATGCTCGTGAGCCACAGTCGGAAGTCCGGGTGTGTCTCCCCCGCCTCGCCTTGAGCCTGCTCCAGCAGGTGTTC
GAGTCGCCCGAGCCACGACACGGCCAGGTGGCAGTTCTGCAGACACACCCAGTCGCCTGTCTCCTTGGCTTGCTTCATGAGGGCTTCTGCGATCGGACCT
TGACCCTGACCGAGCGAGATGATCTTGAGACCCGTGCCTTCTTTGCCTTCCTGCTTGGCCAGCTCCAACAGGTAGTCGTTGATGTCGGCTCCGGGGGACA
GCACAAAGATGAGAGGCGTCTCGGGTTTGGAGTCACGATAGCACCCAGCCAGATCGAACGGCGGCGACTCGGTGAACACCGTCCCCAGCTCACGACCGAC
GAACTCGCGCGTCCCAAAGACGAGCATCTCTTCACGGAACACTCGCAGCACGAGCAGCCGCTGGAAGTTAGTCAGCGTCGTCTCCCACGGTGGTGGCAGC
GACTCGGCATGTGGCAGATCGGACAGGACCATCGCTTGTTTCCATGCTTCCCCATGGGACACCACATGGTCGGCGAGCTTGGCGAACACTGGCGACACCT
CGCGCATACCCACCAACACCTTCCACGTGCGATCCGAGAGCCACGTGGGATGTTTGAGACCGCAAGAGTCAATCAGCGCCTGCTGCGCGGCCGCGCTGCG
CTTATCTCCGACGAGGTAGAAACTCCACTCACTGGCACTGATGGCGCCGCGCTGTAATAAGATGTTGGCGCCGATCATGAAGGCGTAGACGATCTTGTCC
TTTTCGAACAGACCGCGGCAGACGTTGACGAACATGGAGAGCGTGATGTCGTCCATCAAGATCTGCAACCGCTCGGCCAGCACGTCCGATTTGGTCGAGT
TCTCGAGCCGCATGACAAAGAGCTTCTGGTAGAACTGGAGCGAGTATTGGTACATGGGGTCCACGAGAGCGAGGCTTGCGATCGCAAAGTAGATGATCGA
CCCTCGAACAGCGACACAGCGGTAACCTTCGCGAGTACTGTCGATCTCAGCTGATGTCGTCTCGGCCTCGGCCATGCGCGTCTTGATTGCCGACGAAGTG
ACTTTGCTGTGCGCCAGCGTGTTGATCAGCTCCTCGTCGTCGAGAATGTTGCCCTGCGAGTTCTCGAGCATGTAAAGGATCTTGTCTTCGATTTCCTTGA
GTTGTTTCTTGTCGGCGGCGATATTGACGGTGAGCTCGTTCTTCTTCTGCTCAAGATCCGGCCGCTCGCTGCGGACAACATCGACCAGCAGCTGGTCCTC
CAAGCCTGTGAGCGTGACTGTAAAGTTGATGACTGTCACCTTGATGCAGATCTCGGGCATGTAGTGCGGGTTCGCAAGCTTCGTCGTAATGTAAAAGCGG
AAGCTGTCGCTGTACGGGACGTCGCTGTCCCCAAGGTGCAAGAGCAGTTGTCCACCTCGCTTGAACACCTGCTTCAGTAGCACAGGCTCGAGCGACGGGT
CCAGGTCTTCTTCGACGTTCTCCAGCAGTACGGGAGCACCGTACCGGATCGCATTCTCCAACGTACGCAGGAAATCTTTCTGCGACAGCTTGATGATCTG
CAACGACCCGGCGGACTTGTACATGTTCTTGATCCACTTGTTGGCTTGGCTCTGCGGATCGATCATCAGTGGCCAGCGGCGTCCCATGGTAGTGAACAAC
CCGTTCTCGATCGAGAACGTGTCAGCTGGGAGACCCATGATGGTCCACTCGCGTACGACAACCGGGTCTGCAAGCACGCGTTGGAATGAGAAATGGCCAT
CGACCGGCAATCCGCTCTCCTTGCAGAACGAGATCCACTTCTGCTGGAGCTCGTGTCGGTACTCGGCCGTGAAAGGGCCGAGATACGCGATGCAGCCTGC
CGAGAGAATCATGTCGCCAACCAAATTGACCATGTCGATAGCCAGGTTCTCCGCGCACTCCTTCCACCGACCCTGTTCTTCTCCAAGTGAGTCGATCAGC
TTCTCAGCACGCACCAGTTGCGCCTGCGTCTTCTCCGTCTGCTTCTCAAGATCCACTTTCTTCTGCTGAGCGTCCTCGAGCGTCCGTTTTAGGTCGGCCA
CCTTCTTCAGCACCTCGCGAAGCCCAGACTGTTTAATGTCTAGCTGTCGCTGCTCGTCCTCGAGCCGCTGCTCGGCCACTTTCAGATTCTCCTTCTTTGG
AGCGATATTCTTGGCGACAGTGTCGTACGTATACATTGCACGAGCCCACATGCACAAAGACGTCGCGGCCGTCGAAATTGTGCTCAGCGTCTCGGGCGTA
AACTCTTCGTCTGCCATGAACTTGGCGAGTTGGCGGATTGTCTTGGGCGGAATGTTGTCCTTGTCGTACTCCTTGAGTTTGTCGAGAAACTTCATGTCGT
TGAGCAGCTTCTTGGCTTCGTTCCACTCCTGCTTGGCGCCGAACAGCAGGCAAACGGCGTTCATAGTGACACCCACGAGTCGCGGCGGGTTCGTGAACGT
TTTCAGCACAGTAATGTCGTCCTTCTTAAGCTGCGACAGTGCCTTGATAGCCGCATAGTACGCAGGCATGGCTTCATCCAAATCTTTCTGGCAGTCGTCT
TTGATGACCTTGACCTCCTCGGCGATCTTGTTCGCTGCCTCGACGTCAGCCTGGATGACCTGCTGTTGCTTGTCGGCTTCTGCCTGATCCTTCGCTACTT
GCTCCAGCAGCAGTGAAGTATCTTCCTGCGCCTTGATCAGCACAGGCTGCAGGTCAGTCAGAGAGCGCTTCAGATTACCCACGACTTCTTCTGTCTCAGT
GAGTTTCTTCAGACCACCGCGGTATCTTGCTTCCTTTTGACGCACCAGCTGGCGGTGGTTGCGCAGCATATCCACGTACAGCTTGATGAGTTCTAGATAA
CTCGTCGGGGTCGTGTAGTTCCGCCGCTTTAGCTGGTCGTAGAAATGCGCCGTCGCTTCCTCGACGCTGCGGTGAATCGTCACAGCCATCTTGCAGAGTG
TGTCGACGTTGTCTTCGATGCCCAGCTCCTCGGCATTGGCGGCGAAGAACCGCTTGGCGACCGAGTTGAGAGCGTCTTCTGGCCACGCGTTAAACCAATC
GATCGTGCAGCAATTGACGAGAGACGGGAACATACGACATCGATTGCGGAAGCCTGCGCCGATCGGCGAGAACGCTAACACGACGTGTAAATTCTCACGC
ACCAGCGTGACATAGTGTTGCAAAATATCTTCGCGCGTGACCTTCCCGACTTGAAGCGCGATCGGACGCACCATGCCGACGATTTTCTCCGTCTCATCCG
TGGCGAACAGGTTCGGCACTTCGCCCGTGTTGAGAACGTTATTGATATCTTCCAGAAACGACTCGTGGACAATCTGCGCGTCCGAAAACAGGAAGACAAC
GGGCTTATTCTCTGCACCTGCCGTCATGAGGATCTTCTTCAGGTCTTCATGGAACTCGTTGGCGCCGTACCCTCGTGTGATCTCGATTGAGAAGCACTTG
TAGTCAGCCATGAAAGCAGCTAGACGCGTCAAACTCTGCCGACCCGAGCCGCCGACGCCGACCAACAGCGCGTTGCCTCTGGGTTGTCGTAGCACGCGAC
AAATCCGCGAAATGTGGTGCATCGCGTCGTTGAAGAAGACCAAATGCATTTGACTCGGGAACGTGATGTTGTACTCCTCCAGGTACTCGGAGAGCAGAGA
GTTCAGCTGAATCAAGTCTTCAACCGGACGGTAGGACTTGTTCTCCCGCGTCAGATAGTCGCCGTACAGTAGATTTTCAAAGCTGTCGGGCGTCCATGTG
ACTTTGAGGTGCTCTTGAATGAGCTCGGAACACGCTCGGTTGAACCATGCGCGGTCGTCGGCATCAACGAGGCGATCGCGGAAAACGCGCGCTTCTTCGT
GCAGCCACAGCTTGAGCAGTCCATCTTCGCTGGCCACGTTCTCCTTCTTGATCATCAGCACACCTTGAAACACCTTGGACAGGTCACGCAAGTTGAAAGT
ATAGTGTGATTTCGATGGTGTCGGCAGCATCTCCTTCTCGACTTTTTGATACAGCGCCACGGATGCATCGACAATCGAAGGAGCCATGGGAGCCATCCCA
GGCAACTCCGCTGTCAAGAACCCACCGAGAATGGACGAGAATATGCGTGTCATCACATCGCCAGACAGATTTGGGATCCATACCATGTGGAAATGGCGGA
GCAACCGCGGGGTCACTTCGCTTCGTCCACCTCCAGGCGGCGCGCATGCAGCCGCAAACACCACGTCCTTGATGTTCTTGAAAAACATCTTTGCCGTGTC
GTAGTACCCTCCTTGATCAACGATCTGCCGCAGCAATTCGTTCGGTGGTTGAGCGCCGTAGATTTCCAGCGCTGGCATGTTCAGATCGTCGACGAAGAAC
AGCATTCGCTTTCCTGCCGGTGGGCCAAGCAAATTCTTGCGCTTCTTCTCCAGCTTCAATTCAAACTGCTCGTTCAAGTTGCGAGGCTTTGTCTGCGCCG
AGTAGCTCATGGTCGTCGAGATACACCCATCCGTCTTTGCCATGTCATCTAAGAACGATTGGATGATCACCGACTTGCCGACACCGGTCTCGCCGCTGTA
AAGCACGTGACGGTCTGCGAGCAGCAATTTCTCAAGTAAATACCTGAAACGTGTCGTGTCTTGCGTCGGGACGACCATACTGAAATACGACGCGCCAGGC
ACAAACGTGAACTTTGGCGTTTTCTCGATCCACGACACCCAATGACCCGTGGTCTCGTCAATGACGACATCGTAGACGTTCGTGACCGCAGTGGAGCTGC
TGCCGTCTCCTTCGATCAATTCTCGGAATTGACCCATGCAAAAGTCGTTGAACTTGGCTCGAGATGCATCGTCGATGTTGGCGCCGACGGACCACGTGAC
CGCAAACACAAAGTACATGCGCAGCAAAGCTCCAAGGTCGTTCACATTGTCGCGAACCTGGGAAGCTCCGTTGGCGAGACACGAGGCCAAGAGGTTGAGG
CACGACTGCATCAGGTTGGCGTTGTTGGTTGGCACTTTCTCTTTGCAATGCCCTCGCACGTAGTTAATAGATACCGGCACGTGCGTTTCTACGAGTGAGA
GCACCATGTCACAGAGCTCGGGAGACGACAGGATCTTCTCCAGCGTCGTGACCTTCCACGTTCGTGCGAGCGAGGTGAGGCCGACATGAACTTGCTCCAT
GTAGACCATACCACATCGGCTCACGGTGGCTGGCGATGCAACGCGCAGGTCCTGCACTTCAAACATCATGTGGAGTGTGTGCGGGAGTTTGATCCGCTCG
CTGTTGGATAAGCAGAGAGTCTTATTGTCGTCCAGCACGGTATTCATGTTCTCGATCCAAACAGCATCTACAGGTCCATCAAATATCACCCAGTTGCGGT
TATCCGACTCGGCCGCTTCCTGTACGCACTGTCGTACCAACTTCGGCACCAGTCCGTCGGTCCATTCGTTTGTCAGCAGGTTGAATTCGCCGTACAACTG
CCCTGCCGAGATGGATTTCGGGTTCAAGATGAGGCGCTGCACTTCCTTGTAGAACCCATCGCGATCAACGACTCCGTCCTGGCAGAGCTGGGTCAATGCC
CGAGCCAAAACGTAGCAGTTGGTGCTCTTGCCGCTACCGGCTTCACCCACGAGCATCATGCCGTGCCGCACAAGTTGCGTTTCGTGAACTTGGATAGCTT
TCGTGATGAATGACGGGACTTGCTGGAGGTGTAGCAAGTCTAGCTGCTTCTCGATCGCCTTCTGTAGCAATCCGTAGTCCACGAACGGGACGACGACGCC
AGGAAAGAGATCCGCAATAATGCCACGGAATAGTGGCAGATCCTGCTCGAGGAACTTGGGGACGTTGCTGTCGCGCATGGCTCGAATCAACAGCAGATCC
TCATGCATATCAGGCTCCTTGCGTTTCAATTGTCCTGCAGCAACTAGAACCGACTTAACAGCCCGCATCCCGAAATCGTAGTGATCTTGCTTAGACAGCT
GCTCGCTCGACAGTGAGTACAGCTGGGTCATCTTGTTGGACAGCGGCAGAGCGTTGGCAAATCCTTCCGAGAACAGCACAATCTCTGCAATGAGTCGGTA
ATCCGGAACCATCATCGCCACTGGCCGAAACAGCGCCTTGAGGTTGTCAGGCAACTCGGTTCGGCCAGCGTAGCCTGGGTTCATCGTGATAAACACGCCA
AAGCCGGTGTTCAACCTGATCAACTTGCCTTCAAACTCGAACTGATCCACGTCTGCAATGATTGCCTGCTGGATGCACAGCACTTGCTGCGCAATTACAG
AGAGCACTTCGATGTCAATGCGGTTGAATTCGTCGAAGCAAGCCCAGGCGCCGGCTTGAGCCAACCCGGAGAAGAAACGCCCCATTATCTTGTAGTCCAG
GCCATCAGAGCAGTTGAACACGACACATTGAACAGCCAGTGCCTTTGCCAGATCCTTTGTCGTTTCTGTTTTGCCTGTTCCTGCCGGACCGGCAGGAGCA
CCGCCGAGACGGAGATGAAGAGCACCCGTGAGAGTCATGTAGCAGATGTCCGTTAGCGGGGTGATCACCAAGCGCGGCGAGTTCCCGAGGTATTCGTAGC
CATAAATAAAGCGAGTATTCGTTTGTCGAGCGACAAAATTCTTGATGTCGTCCTCCCAGTAGTATCGAAGCTGCCGAGTCCACTCGAAGTCGTTCAGCGT
TGACACCTTGCTGTCTCGGAGCGACCGAACCACGTCGCGAGCGTGGACATCGATCGTGATGATGGCACCCATCAGAATGCGCTGAAGCTTGCTGAGAGAT
CCTCGAACGAGCTGCACCATGCCATCGATTTGCTTCAAGCTGAACTGCAGAAAGCCGTCGATTGCGTTCGGGTCGCTCCCGTTCTCGACCTGTGAAATCG
ACTCCGTGACATTCCGCGTCCAAAACACTTGATCAACCAAAATGACGATTTGCGCCGAGTACCCGAACAGCCAGTCCTTGCGGTCGATTGCGTCTTCGAC
TGGATAGTTCATCAAGGCCTTGACTCCGTCTTCGTATAGGCTGGCTCGCATAGCCTTCTCGACTTCGACCAGCCACATCTCGACTGGCCCTTGAGCGGTC
ACTAGACTCGGAAACTCAACAATCTCGCCTTCACCGCTCACCATGGCGTTGACGACGTTGCTTGCAGCGCCAGATTTGGTTGCTTTATCATCGAATCGAA
TGCTCTTCATGGCATCGAAGCACTTGCCCAAATGAGGTTGCACGGCGCGTGGGTCGCGTGTTTGCGACAAAATCTCGAGCAACTCGTCGTTGGATAAGAA
ATAGAAGCGAGGAAAGCCCATGCGTTTGGTCTCCAAATAGTCTTCGAGCGATTTCTGAATCTCCTCCAGGATTCTGTTGGACATGCGAAATTGATCAAGC
AGTTCATTACCGCCCTCAACAGACCGGATCACGCTGGGGTCGACATTCGTCCGCACCATCACTGCTTTCCAATTTCGATCCACTAGCGCGAACTTCTGTG
CCTCCACAGGCAGCTGCTTCTGAATATCTTCGGCACAGAAAATCGTTTCTAGGTACATCCAGCCGCGCTGACATGTGATCCACTCGTCAAGAGTTTCGGA
AAGCAGAGACAGTCGTTTGTTCCAACGGTCGACATCGTCCTTGACACCCATGATGAATCGCGATCCCATCATTGTCTGGAGGGTCACTTGGTTGTCTTCG
AGCAGAGTAAGAATATCTTCTAGTCCACCCAGGATAAACACATCCTTCTGTTCGCGGTGGCTCAAGCAGATAAACTGCATTTGATCCCACCCGTGCTTGA
TTTTCATCAAAGACGCTTCGATCTGAGCCTCCCCAGACGCAGCAGCCGATACTTCGCCGACGAGTTCTTTCATATCCAACACGTCGTATGCAATCAGGTT
CTCGAGTGTGAACACAATCCCAGGGTACCACGGCTGTCGCAGCGCCTTGAAGATCTTCTCCCAGTGCCTGTCTTTCATGGCAGGATTACCCAACTCCAGG
ATGGTAGGGACTTTGAGCTTAAAGTCGGCCGTCCGGTCCTTGAGCACAGCAGTGACGTCATTGCTCAGCTTCTTGTGCAGCGCGTAGGCATCTTTGAATG
CCACTGCCACCTCCTTGGACAACTCCTCGGCGTTCACTTCGACAAACGAGCTGGTCATCGCGGTGCCGTAAGTCGAGTTCCACTTTTCGACTGAGGTCCA
TAGCGTTTCAACGGTGCCAAAATAATCTTGAGTGGCTTGGAGGTTCAGATACTTGAACGGTGTCAGGTTGAACAGCGTTTGGTACTCTGTGTACTGCTTT
GACAGTTCATCAAGCTGGGATAATCGCTGTTTCACGGAATCCAGCTCTGCTTTCACCTGAGTGGGGTTCTCGAACTGGTCTGCATCGATGAATATCCCGG
TCTGGAGCTGTCCGTTCAATTGCAGCACCTGCTCGTCTAGTCGTTGGATATTCGTATCCAGCTGCTGTGTCATTTCCTCAAGCCGGCTCTGGATGAACCC
GTCGACGGCGTCAGTTTCTTCGCGGTAGTTGTCTTGAACTCCGCGCAAATCGTCCAGTTGAACCATGTCTTCGGAGGAGATACGAACGCCGTACGTGCCC
AGCAGCCGGTAGAGTTCGTCTACTACGTTCGTGTTCTTCGACAGCGCCTTTTGTTTCCCCTTGAGGCCTTGCACGCGCTCCACATGCGCAGCAAACTCCT
TTAGATGCTGGGGTCGCTGGAGTAGCGCCTGAATGCGCTGTTTGTATTCCACCAACTGGTTTTTGCACTTGGACCGCGCGAGCTCCTTCACGAGCCCTTT
CATCGCATCGAGTTTTGCTGTAGTCATCGGAATGAGCGTCTGCTTGAGCTTCCGGCTCTCGACATGCAAGATGCCGATGGTTTGTCCAGCCCTCATCTTC
TCCAGCTCTTTCTCCCACGTACTTATCTGCAGCATGTCCGCCTTCAGCGAGGTGACAGTGTGCGCGCGCTGGGAATACTCGTCAAAGTCCCATTCCTTGT
CGTACTCGTAGATCGGACGCACACTGTCGAAGATCTTGACGTACTCAGTCGCTTCGGCATAATCGCTGATGATCTTCGCGACCAAGTCCTTGCGGATCTG
CAGGAAGTCACTGCTACTCGAGATCGTACTGCCAATGTGTGGAGGGTCCGCGACACTGTTGCCAATGTATGGGACAAACGGTCGCAGGTACAGAACGCGC
GAGACGGAGTTGACGGTACTCACGATATCGTCCGTCATGGACACAACGATGTGCTGGATCTGCTCGCTGGTGGGTGAGAACAGCGTGATCTGCTCTCCAA
AGTTGATGGTTGTCTCGAACAGCCCCGTCTTTCGTGGCACCTTGTTCAACTCGGTGAGGAACTCAGCACAGCTCTGAATGGCTAGAATCACAAGGCTCTC
GACCGCTACATAGTCTACGAGGCGAATGAAGTCGGAGATCATGCCGGCTTCTTCAGCGGCGCGCTTGAACAGCTTCTTGCGCTCGATCTGCTCGGACTTG
AGGGCGACGATGGATTTCATTTTCTCCTGGCCCATCCCAGACCCTGACCCAGTGTACGAGTCGGAAAGGAAATCCTCCTGCGGGTCGGACACCTTGGTCA
AGTTCTTCACGTCCACGCACAGTTTCTGAATAATGGCCTGGAACTTTTCGATGCACGTCTCGAATTGCTTGGACCCTTCGCTCCTCTTCGTCGCCTGGTA
CTCGACGAATGCCGCGCTTTCGTACGTCTTTTGTGCCTTCAAGTCCAGCAGCACTACGCTCATGAGTTCCGTGCTCACGACCTTCTTCACTTGGAGGAGC
GGCACGCAGAAACTCTCACGTCCAAAGAACAGTCTAGTCTGCAGTTTCTTTCTTTGGCGGCAATACAGTTTGTAGCGAACATTTGCGCGCCATAAAGAGA
ACGTCTTGTTGACCAAATAATGCTTGAAGAACCGGAGCGATGTGAGGATATTGAAGAGCGTGGACTGTCGCATCCATTCCGCAAGCGCGATAAACTCGGA
CGGGCTGCCAGGACTCATGTGCACCAACCCGCTCGAAGACATCGTAAAGTGCTCCACCGCGAGATCATCTGGACTCACCACCGCCAAATCGTATGGCCGA
AACGCGATCCCAGTGTTGGCGCGGTTCAGATGCACGAACTTGACCTCGCTGTCCGAGCCGTTCTTGGCGAAGAAGGCGATGGCGTCTTCGCCGCTCTTGA
GGAAACTGGTCGCTGAAGCGGCCGCAGCTTCCGCGGCAGCGTCTGCTACCGCCACTTTCGATTCCCTTGTCACAGGGTCCACGTTCTCGACGAACAAGCT
GGGTCGTCGCTCTTGGTTCACAGGCTGCTCCCCACTCTGCGCCATGGAATCGCCTCGCGGCTCAGATATACCCAACGACTCGCGCAAGAACTTGCGAGGC
GAGGCCTCTCGTGTTGGTTTGCTCGGTTCGTTCACACTGGTCTTGTACTCCACGCCAACACGGTCATCAGCGCCGCTAGCAGTGCGATGGCCCGTTTCAG
GGGATGTTAGCCCTTCGCGCCTTGATCGCGATATGGGACTGCCTGTTCGAGTGATGGATCCTTTCTTCTCCGGGCTGCGAATTGTGCCTGGGAACACGGG
GATCTTCTTCGGCGACGTGTACTCTTTCGACATGGTAAACGTGAACTTGTGTGCCTCCGAGCCGCCCATTACCGATGTTGGCGACGGCGCCATGGCGACC
GCCTGCATTGGCTTGTTGGACCGCAGAGTTGGCCCAAAACCCGTCCCGCCGTTGAATTCGAACGCTTGGTCCACCGAGATCGCAAACATCGACTGGGTCG
CTGCTGCATCGTGGCCGGAGGCATTCTCCTTC