Description :
From Genome Similarity Track
Location :
Scaffold_835:6291- 7597
Transcript NameFunction/comments
g12088.t1RAW39483.1 hypothetical protein PC110_g4283 [Phytophthora cactorum

Sequence
1306 bases(100 bases per row)
GCCGTCGTCTGGCTCTCAAACTCTCGAAAGTCCTCGAGAATACGCAGTAAATCCTGCTGCACCTGCGTGCTGCTGGGTCTGTACTTGGGCTTGTAGCTGG
TGCACGCGCTCACAAGCTTGACGATGCTCTTGGGGCACGTCGGGGACAGCGTGGGCGTCAACGCGCCCCTGGCGATCAGCTGAAGGATGTCCGTCTCGGG
CACCGCGGATCGGTTCGCCTGCATTAAATCCGAGAAGGGCAGCTCGTGCGAGTCCATCTCGGCGATCAAAATCCCAAACGAGTACACGTCGCTGGCGTCC
GGGTACGACGCGCTCGTGTCGCGGCCCATAATCGCCTCGGGCGTGATCCACCGACCCGACCCAACAGCGCTATATGACATGAGCTCCTGCTCGGTAAGAC
CGTCGGAGCGGCCGTCTACACCAAAATCGCTCAGTTTCGCACGCAGGGAAGTGCTCAACAGTACGTTACGCGAGTTACAGTTCCCGTGCACCAGACGTGG
GTGCATGGAGTGCAGGTAGAGCAGCGCTCTGGTCACGTCCAATAGCATCTGCACCTTTAGGACGGACCACTTGCCAGCTTGCCGGTGCGCAGTACGATGG
AGCCATTGCCGGAGATCACCTTGAGCCATGTACTCGGTTACGGCCACTAGGTGAGTCTCGCGAGACCAGGCCACGCCAATGAAAGCCACGATTTGCGGAT
GTGAAAAGATGGCTTGGCGCTTGAGTTCGCCCTTGAGTTTATCCCTCGCGCTGCCACCTCCACCCCCACTTGCTGACGAACGTGGTCCTTGGTCCTCTTT
GGGTGTCAGGAACTTTACCACTACTAAGGTATCCGTAGTGCCTCCTCCAGGCGATACAGCCGCTGTCGACGCCGCATACGACGCCAGCCAAATCTCTCGA
GGGTTCATGGCACTCGTCACACTTTGTTTGCGCAGTGTTTGTCGCTTTCCAGCGGGAAGCAAATTAAGGCACTTGAGCATCTTGAGGCGTTGAAAGTCCA
AGCGCCACGGCTGCAGCTCCTCATCCACCCAAAAGCCAGCGTTGTTGCTGGTAAATGGCTCCTTGTCCTGCCGCCGATGAGGCCGCGGCGAGGGAGACGC
TGGCGGAGAGGTGCTCGAATCGTTGGTCGTCGGGCGGTCCGCGTCGCTGTCGTTGATATCGACGTGTTTCGTATCGGTGGGCCGATTGTCTCCGTGTGTC
TTCTTGTACGTGAGCATGAAGAAAACTGCGAGTCCAACCTTGTACAGGAAATAAAGGAAGGGCAGACCCATGCTTAGCAGCACGAGGGTGGACGTGTCCT
GGTCGG