Description :
From Genome Similarity Track
Location :
Scaffold_276:6290- 8527
Sequence
2237 bases(100 bases per row)
CACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGGTCCGTCG
AGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGTGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCAC
GAATCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGATTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGT
TTTATTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGTGCGTTTCGATCCGGCCTCAGCAAGACTTCA
TGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTCCATCCGTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGCTATGCACCT
CGTCGGGAAGGCACGTCGTGCCGTCCGCAGTGTCGATACGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCGCC
GACCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCCACACACT
CTTGCGTGATCTTCGTGTCAATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCACG
GCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCGCTCTCCTGGTTGCAAGTCGATC
TCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCATTCTTGTGTGGTACGTTCCGGGTTGGATT
CACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACATGTCGCTCGTCTCGTAC
TGGTTTCCAAGCCAGCGAGCGTCCTCGTTTAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGGGTCAAACCACTGGCGCAATTGGT
TGAAGAACTCCTCCATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGCTGGCCACCACACTT
CTGACACGTCAACTTCCAGCAGTCTCCTTCGACATGGCGACGTGAACCACAGTGGTGGCACCGCGGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTG
CGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCGCCTCGTCTTGGTCGTACTGGCGATCGTCGCTGTCGC
GACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGCATGCACGGCGCGCGCCGGCTGAGTCGGCGGGGTCGGCGCCTTTTGGCGGAACTT
GTTCGAGCCGAAGAGAGTCTTTTTCTGGTGAGCCAATCCACGTTGTCGGGCACGCAGCTTCTTCTCCAGCGCCTCGGAGTCGGCGACCTCCGTCAGCGTG
AGACGCGAGGCGAGTTCGGCCTCCTGCGGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCGTGCCCTCGGCGTATGGGATGTT
GGCCCTCAAGCCCGCGACGTTGAGCCGGTACAAGTAATCCAGAGGGGTCTCGTCGGGGCGCTGAGCCGCATGGTAGTAGCGACTGGCCATTGACACGCCC
TTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCATGATTTCTTGACCTTCCTGGGCAACTGGAGATACCATTGGCGCGCAGGACCGCTCA
TTAGATCGCTGAACTGCCCGCACACTTCTTCGCCCGTCATCCCGTCGCGCCGCGCGGCGGACTTCAGACGGTTGAGCCACAGTCTGGCTTTCTCTTCGCT
CGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGACGATGCTGAGAGGCGTACGCGGGCGAGGGCTACGCCGCCGGCTGTCGCCGTCGAGACGGCGGCCGCG
GTTCTTGGCACTCCGATGTCCAAGTCGAACAGGTCAT