Description :
From Genome Similarity Track
Location :
Scaffold_99:6290- 7763
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_99-abinit-gene-0.79Conserved gene of unknown function

Sequence
1473 bases(100 bases per row)
GGTGGTGTaTGTACGTCCTTGGTGTCCATCCTTGTGCTCGTGGCGTCCTGCTCGTCGCTCTACAGCGCGTCGCGTGCGTCGAGGTGGCGTGCGTGTCGCC
TGCTTTTTCCCTGTCGAGCGTCATGAGATGCATGCGGTATCGCATAGCAGAGGGAAACTATTCAGTGTCGAAGGCTTTCCACATTTGGGGGACTGGTCGG
TGTCCAGTTTCTGCTAAGTTCGAACTAGAAGAAGACAAGAAACTTAACAGGAagAAAACAAGACAGTACTGTGAGGAGTCAATTAAGTTAACGGCAGCGT
TCAGCATCAACACGAGGATGACATGAGGAAGAGCGGCGCGACGCATAATGCTTCCCACTTGAGCACGGAGATAATGAGCTCGAAGAGCCAGTGCTTGGTG
GTGACTTGCGAcGGGTCGCTTAGTGAACCGCCCACGATGACCTCACAGCCGATGATGTTACCCTGAGCGTCGTAGACGTGGTTGAACAAGGTCCAGTTGT
GAATATCAAACCAGATCTCATGCGGTTGTAGTGTGGCCTGGAGCTCTGGGATGGGGATCGTGCGGAAGCACAGCAAATAGCCGTGTGGAGTCTGCAGACG
GAAGAGGACGTGCACGGTGAGGAATATCATGGGCATCTGTGGGTGCGTGTGGTCGCGTCGGATGATCACCAGGTCGTCGTTgaTCACTTGCAACGTTTGG
AACGCCGTCGTAATGGAGGGATCCACCAACAGCCGGGCCATTTTGCTTATGTCACGTAGCAcGTCCCAGGATTTGGTGAGCAGCGTCTCGGCGTTTTGCC
CCAAGAATGTCTTGCGGAAGCCGTAATGCAGATGACCCGAGCCTTCCTCCACACGCCGTTTGTCTGTCCAGCCCATGATGGACGCCCCcGTTGTCTCGAA
GTCGTGACTTTCGTCGAAGCGAGAGATGAGCTCGTACGTTTCTCGCAGAAACGCAAAGCACCTTGCGGGgTGAACCCACTCGCGTTCTTCCATAAGCTGT
TCGCTACTCGGCGGTGGGACACTTGATGCCGCCTCGGCATCCTCACTGAGCTCACATTTCCACGCAGATCGCACGGTTTCCTGGAAAATCTCGTGTTCTT
CCATCAGCTTGCGCAGTTGAgtttGTTCTTCTTGAAGTAATTGGGCCATGAAGCCGATTCTTCGATGCACACGCACTTGATCTCGGTGGCTCTTGGCCCG
TACGATGTGCACACTTTTCAGGATGTCTTCGTCATATACGATCTCTTCCAGACCTTCCTCGTAGctCAGTCGCTTGTACTCCCACTCCAGTCGGCcGAGC
TCATCGCGCATGCGATTGAGTTCATCAAGCCTCCGCAGTCGCGACTTGCGCTCAATCTCTGACCGgCGAGCGCGCTTCAGCGCCAAGGCTTTTGGTGTCA
TTGCCGCTTTACTACGTCTCCTTCCCGGGGCTTTCTTCTCTTTCGGCGGAGTTTCCTGTTCCACGGGCGATCC