Description :
From Genome Similarity Track
Location :
Scaffold_66:6290- 7381
Sequence
1091 bases(100 bases per row)
CGGGAGGAGAGTGAGGATTATATGCTTCCTCCGTAGGAAGCACGGGCCACTTCAAGCGAGACTCCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAA
GCCCGTCCTCAAGGGTCGCTGGCAGAAAGCAGGATCCCGGGGACAGGGGAGCGCAGGGAGACAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTC
TTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGT
ACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGC
AACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGG
ATCAGGCAGTTGAAGACTTTGACAGCCTCGACCAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCCTGGGCATGCCCTGGCTTGAGGAGCACG
AGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGAACCCG
GGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGATGATGTTTTGATGGGGGCCGCG
CCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGT
TCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACATCGGATACGCTTCCTGTGTGAGTAACACAGTGCCACACGC
GAGTCGCCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGGCCACGAGTGCCTCG