Description :
From Genome Similarity Track
Location :
Scaffold_2091:629- 3293
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2091-snap-gene-0.1Tau-tubulin kinase

Sequence
2664 bases(100 bases per row)
TCTGCTGCGCTGGGTGCTTACTTTGACTCCCATCTCGAAGGCCGACGAGAACCATCGCGCGGTTTGCTCGATTGCTGAGAGTTATCGTGGTGGCGGTGGT
CTCGGCTATGGCCACGATGCTTGTCATCACGGGAACCAGACGAGCGGTGGTGATCTTTTGATCTAGAGCGATAACGAGAATCGGAGGATCGGCGGCGTGG
AGAGCGGGATCTCGACTGGGAAGACGATCTCGATCGNNNNNNNNNNNNNNNGCGCGGCGGTGTCGACTGCGGCCGCGTTTTCCTGAATGGATCGGTGAAC
GAGATCGGGAGCTGGAGCGAGAGCGAGAATGTGACTTGGAACGGGATCGAGACCGCGAGGACGAGCGAGAGTACGAACGCTTGCTTGGTCGACGCTTACG
ATCCCGTGATGACGAACGTCGCTCATAACGCGTTTTATCCTTCCGGCTCGAGTCATGATCACGATCGCGCTGGTCACGCGAAGAGGAACCCGAAACCTGT
TCACGCCTATTGCTACCATTTTGATCGCTGGCTCCGGATGATCGGCGCTCCAGCTCTGGCTTCGCAGAAGGCCAACCGTTTCCCTTTGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGAACAAAACCTGCTCCTGTCGGTAAATATCCTGGCGGAAGAGGCGGTGGAGGCTGGCCCATGTACGCGCCATT
TTGTGGCGGCCCAGGAGGAAGCGGTGGACGCGGCGACGNNNNNNNNNNCGGTTTGGTACCATTGTTGTTCCAGCGCTGTGGGGGAGGGCCAGGTGGAGTG
AGAGGTTGCAGAGGTTGCGGAACAGGGACAGGTTTCACATTTCCGCTCACGTTCCCGTGCTTTTGAGCGTACGAAGGCGTCCCAGTCTCTTCACCATCAG
ACACCTCCATGGCACTATCCTCTGACATGTGGTCGATCACTTTTACATCGACTTTCACAGGAGTCCCGCTGGAGCTTTTACTATCGTTCGTTGGCAACGC
AGCTGGTGCAGTATTCTGACGCCGAGCTTTTAGTTCTAGTGATTGGCGAACCTGGAAATCCCGCTCTCGTCGTCGACGTAGCGCGTCACTGCGTAGCTTT
TGCTCTGAGAGACGGCGCTTGACAAAACTCTGAATCGGAGGCGGGGCAAGCACCTGGGATAAATCACGAAGTTTCTTCTCTATCCGATACACGGCTTCCT
GAACCTCGACTCGCTCTTCACCTGTCAAATCCAAAACGCCAAAGAAAGTATTGAACTTCTTCGCCACCTGAAACATCACAAAAAAAATATTTTGTCAGCA
AAATAAAATCCAACAGTGCTGCAGCCCATGATCTCAATTTGTCACCTACCGCTAAAAGCGTATCGAGGACGGATTGAGGCGTATTGTCCTTCACCACGGC
ATCTTTTGCTCGCATTGTCCACTGCAGCGCACGCTCGCGTTCAGATTCGATTGCGTTCCATAGCTCCATCGTGTCCTCTTCTTTCGACCCGGTTTCCACG
CGCTTCAGTTTTCGCCGCAAGAAATCATAATCTGGTTTATCTTCGTATTTCAGCGATTGCAGGTATTTCATCATCGCGACCAGATGACTCGCACCGACAA
GTCCTTCCACCAGCAAGGACGGGCATTTCTCCGTGTAGTACTCTTTCAAGTTCAGCACAGTTTGGCGGTTCTTTTGCTGCGCATCGGTCGCCCACGGCAG
CTCTCCACGCATGAAATCCATCACCAAGTAGAACCACGACCACAAATCGTCTTTCGGACCAAGTTCTTGGCGGCGGTGGGAGCTCAACGACGCATACATG
GATGTGCCACGGAATTCGGCCTGGAGTCGAGCCGGGATCACTTTCTTGTCCTCGCCAAGGTGCTGGCGCGACAACCCGAAGTCGATAATATAATATTTCC
TACCAAATGCAGTCACCAGCAGCAAAATGCTTATTAGAAAAAAAAAAACAACGAACACACGAGTCGCTCTAGTTTGTATGGCATATGGCTAGAGCGCATA
CCCCTTTGCTGGACTGCCTGCGTCTGCCATCGCAAAGTTGGACGCCTTGATGTCTCGGTGCACATACCCATGCTGGTGGAAAGCTTGAATACAGTCTAGC
ATCTAGTAATGTAATGCATTACAACAGCAAAAGATTAGACACAACTCATTGATAAGCCTTCATCATGATGATACATAAATCATACCTCGAGACCAACAGA
GACACAGCGTTGCAGCGGGACGCCGTGGATCGCGTCAGGTGTGACGCGCAGCATCGACATGCTCTCGCCGAGCAGTTCCATGACGAGCACCGTGCTCTCA
GCGTGCTTCCCATGGTAAAAGTACCGACACACGTGGTTGCAGTCCTGAAGGCTTTTCAGGATCGAGCTTTCCCACTCGAGCACAGGCTTCAGCGAGCTCG
GCGCCTCCACCTTGACAGCCACGCGCTGGTTCTCGTGGATCGAGTACGCGAGGTAGATCTGGCTGAACGTGCCTTCGCCGATCTTCTCGACGATCTTCCA
GCGCTCGGCGATTACTTCGCCAGCCTAAACACAATTCCATAGTAAATGCGCACCAAGCCAAACAAAAAGCAAACAACAGCATTTAAATGTCATATTGCCA
CACCCGAACCAAACGCAGCGGCAGAAGAGCGTACCAGCAGGATGTTTTTGTTCAGCGCCTCCAT