Description :
From Genome Similarity Track
Location :
Scaffold_10:628951- 665808
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004554Similar to Alkbh2: Alpha-ketoglutarate-dependent dioxygenase alkB homolog 2 (Mus musculus)
Pytul_DAOMBR144PYU1_G004553Similar to Cyt-b5: Cytochrome b5 (Musca domestica)
Pytul_DAOMBR144PYU1_G004552Similar to C8orf82: UPF0598 protein C8orf82 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004551Protein of unknown function
Pytul_DAOMBR144PYU1_G004550Protein of unknown function
Pytul_DAOMBR144PYU1_G004549Similar to ppk14: Serine/threonine-protein kinase ppk14 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G004548Similar to Sel1l: Protein sel-1 homolog 1 (Mus musculus)
Pytul_DAOMBR144PYU1_G004547Similar to WDR66: WD repeat-containing protein 66 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004546Similar to MCTP1: Multiple C2 and transmembrane domain-containing protein 1 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004545Similar to lack: E3 ubiquitin-protein ligase Smurf1 (Drosophila melanogaster)
Pytul_DAOMBR144PYU1_G004544Similar to optn: Optineurin (Danio rerio)
Pytul_DAOMBR144PYU1_G004543Similar to tif452: Eukaryotic translation initiation factor 4E-2 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G004542Similar to Smurf1: E3 ubiquitin-protein ligase SMURF1 (Mus musculus)
Pytul_DAOMBR144PYU1_G004541Similar to YOR059C: Putative lipase YOR059C (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G004540Similar to KHK: Ketohexokinase (Homo sapiens)
Pytul_DAOMBR144PYU1_G004539Protein of unknown function
Pytul_DAOMBR144PYU1_G004538Similar to Rnf181: RING finger protein 181 (Rattus norvegicus)

Sequence
36857 bases(100 bases per row)
CCGCTGCTGCTGTTGCTGCTGCTGCACGTGGAGCTCAGGATTCTCAGCGTCGCGCTCCATTCACGTGGCAAAGCGTCGATGCGCAAGCCACGCACCTCAC
CACACCAGAGTTACCATCATTATCATCACCAGCATCAACTTTATCGTGTACTGCTCTCAATGCAAAGGTGCATTTCCTCACAAGCGACAAGACGAGCTGG
GTCTACTACGCTCCGCAGTGGTATCGCAAAGTGTTCAAGCAGCAGCACGTGACGGAGCCTGACTGGAAAACCGCTTATTCCCAGTGGCTGGACCGCGTGT
GGGGCCTGCATCCCCCGCAGCACGACACGATCAAGATGTTTGGCAAGGATGTGCTCATGCCGCGGTTCCAGCAGGTGTATGGTGGCACCGACTACCGCTT
TTCCGGCCAGACGTTTGCTGCACTGCCGATCCCAGACGACCTTGAGCCGTGCATTAACGCCATGCGACAGCTCGTCATGACCCCGATCGATACAACATTT
TCTCTTGACTTTTACCGTGGGATCCTCGTGAACTGGTACGCGAATGGAGACCATTACATGGGCCCACACACGGACAACGAGAAGGCGCTGGTACCACGCG
CGCCGGTGTGTTCGCTCTCACTCGGCACGACACGAAGGTTTGTGTTCACGCCCAAAGACTCAGGTCTAAAAGAACACGAGAGGCTCGAGCTCATGCTCCA
TGATGGCGATCTGGTTGTCATGGGCGGCACGACGCAGGAGACCCACAAACACGCATTGCCGAAGATGAGCAACCAGAAGTTCGCTGTAGGTAAGCGTATT
AACGTCACGATGCGGTGCTTCCGACAACCTTAAACCCCATTTTCATAAGCCAGTGACTGAGAGAATCAATGCGCATATAAGAAGAAAAAAGTCACACTCC
TTCGTTCAGGAAAATAAAACGGGATATATAAGGAAATACGGAATATAACGACCTGGCTGAGGCAATGCGCTTCTTGCTTCTTCTTTTTCTCACTCAATTA
CTCACTCGTGGCGTGGCGAGATCGCGCGATTTCTTGATCGACCGCGCGTGGAAGCGGAGCACAACGTCGGTGAACGTCGACGCCATGGGGCCGAAATTAT
GCGCGTTCGTTATGCACCACGAGATGCGCTGCCATCGCGTGATGACTATCGCGAGGTTCCCATGTAGCCGTGGGTGCGCCTCGCGGTTGCACAGGATCGG
ATCGTCCACCATGAACTCCTTCATGCTCTCTTTGGCCTCCTGTGAGTGCTGGAACTGGTCCCAGATCTCGGTCGCGTCCGTGCCGATGACGTCGCCAATG
ACATGGTACCCGCCCGGGTGCGAGTGCAGGAACGCCGTGACGTCGTATACATGGTCCTCAATCGCGACGCATTTCTTGTCCTCCTGAAGCCCAAGAAGCC
GTGCGATCTCGACGGCGCGCGACAAGTGGTGCTGAAAGTAGAATTGCCGCCAGCTCTCGATCGGGAACACGACCTGGAACCGCTCGCCGGTTTCCTCGAA
GTCACGCTGGAACACGAGTCGCCAGAGCGAGTCAGACGCGTCGCCGGTCACCACGTTCATCTGCTTGCTGACCATCGGGCACGCCGCAAGATCTTTGGGG
GACAGGAACAGCAGGAGCTCATGCAGCACATCCAGCGGCAATGCCTCAATTCCCGGCGGCTGCTGCTGGTTGCTGAGCACGTCAGTGTCGGCGACTGCGT
TCTTGCAAGCGTTCGTCGGACTTTGCCTGTTTTTCTTGATAGCAGCAACATTTTCGTTTTTCCCAGTATGCTTGCGCTGGTTGCGCACGAGCTTCTCGGT
CAGACGCAGTTCGCGCGTGAGTTCGTCGTCCTCGTCCTCGACTTCTTCATCCACAGCGCGCTTTTTGGCCTCCTTGGCCTTGTGGCGGATCAGTCCAAAA
AGCCCCATGCACGCGAGGATGCACGTGTACTCGGACGATCCGAACTGCGCACCCACCGTCGTGTCCGTCTTCATCGTGAGCTGGCTGCTGCCATGGGTCA
CAAATTGGTACAATGTGCAGGCCACGGCCGAGAACACCATGAACTGCACCAAGCGGTTGCCCTTCGTCACGTTTGGTGGCACGACGACGACTGGCGCAGT
CGCATCATCCGCTTCCTTGTGTCGTGGTGAGTTCACGAGCACCGGCATGCGTGGCAGACCCAAACCAGCGACTGCGACCGCTTCGTCGTTACTGCTACTG
TTGCTGCGGCAGTAGGCCACAGGGCGAGGCGCAGGAAGCGCGCTCATGGGGCAGGAGACAGGGGAGGACTCTCAGTACACTGACGAAGGGGTACGACGCT
GCTGGTGAAGATACACGGAGAGGTGGAGGCAGCAGTTGAATATGGGGAAAAGCGTTCCTTTTTCTGCTTTTTAGTGCATGTATGCTGATGGCAGCTCTGT
AAGAAAACCATCAGCAAAACGGTGGGTGAAATGGCGTAAAGTGTCGCATTTTAGGCGCGTGGCATCATCTAAAACGGTCGCTAATTTGTATGATTACGAA
TGTATTTGGACGAATCATAAAACAGTGGTTCTTTTCGTAAATCTTCTGATATCCTACCAGCACCATAATTTTCAGGAAAGTGTCCTAGAAGGCACTTATT
GCCTTTACATACCCCAGGAACTCGTTTCGTAAATATTTGCGTCTCCTAGTTCTACGACTACTTCCAGGACAGTGTCCTAGTGTTGACTTATCATATTATT
ATTCAATCGCTTTGATGGGATAGCGCTGCTCTTGCCATTCGATTTCGCCAATGATCTCTGCATCGCCGGTAGACTCTTGCTCATTGCCTTCCTCCGCGTC
ATGAACAATGATGTGCTTCCCCAGTTCCACGGCCAGTTGGGATTTCACGAGCGCCACTGGCGGACCAGCGTCAGTGTCGTATTTGGTACGGAGGTCGTGG
TACAAACGGCCCGTGGTGAGCGAGATCTTGAGTTTCGTCGGGTCAAATGGCGCCTTCAACGCTCCACCGCCGTACGCAAACACCCACTGCTTGGTCCTCT
CATCTTGATACAGATCTTCAAACACAAAGGGGCGGTCGGCGCACTTGATGAAATTCATCTCCTTGCCACACGGGGAGCGGTACGGATACTCGAGAAACAG
ATCCGCGTCGTCACTCTCATGGCTCGCTGCTGGCGGCACATTTGGTCGGATCTGCGAAAAGAAAAACTTGAGAAACTTGGCGCTTTTCAACGACGTCGCG
ATGTTTTTCGGCCTCGTGTTCTCCAAAAAGAGGCGCCCCTAGGTACAGGAAAGAATCGTGCCCATCGTAAATGAGTCGTTCACAAGATGCTCTAGCATTC
TTACAGACAGCAACAGCACACTTTCGTGCATACCTGCAAGTCAATGTAGTAGAAATACCTCCGGTGCTGTCCCTGCAGATCGTAAAACTCCTCGCTGGTC
CAGAAGTCAACGCAGAGTGATTTTTTCTTTTAATTGAGCAAAATCATACAGCACACACAGTGACGAATGTGGAGCTGTGGTTGCAGAGGCAAACGCACCT
TTTGATATCGCGGAGCTGCTTCAGTTCGAGGTATTTGTCTTCGTCATCCATCGAGTGACATCGCCGCGTCTGATTACGCAGCACACACTGCGGCGCTGGG
AGGCACCATCGCGTCGAAACGGCCGCGCAGACGCGCACTCGTGGCATGCGTTGCCATCGGATCATGCTCCTCGGAGACTTTCTCTTGTAGGAAAACAAAC
AAAAAGCAACGTCACTAAAACGAAATCCCTGCTTTAGTGTCATCCGCACAGTGTCGTTTCGCATACTTGAAGTTGCCATGAGCGACTCGGACTACTCAGG
GTCCTCGTACGACGATGGCGATGACGACGGCTTCCTCTTTGAGTCCAACGAGGATGCAGATGACGCGCCCAAGGTGCTTAGACCGCAGGCTCTGTGGCCC
CCAGCAGCGCAGCACAACGGCGACCCGCGAGCGCCTCCGTCGCCACTCGTGCGCCATCGGCACGGACGCCGCGTGAGCCACGTCGCAACCTCGGCAAACG
AGGAGGTCGCAGCGTACACGGAGGCGCTGCGCACGACGACGAGTCGCCGCGGGAGTATCTCGGCGGGCGCGTCTAGCGGCGTGCAGTTCCTGCTCTCGGA
GGAGACGCGGCGCCGCCATCGCGACTCGAAACGACGCATGGAGATCGCGGAGAAGACCCAGCAAGCGCTGCTCAAGGCGCATGAGTTGAATGCACTCGCT
GAAGACATGTCGCTCTGGGTGCACGCGTTCGTGATTCCGCCTCGGTGGCGGCAGCAGATCGTGGCGTACTTGACGCCGATCCACAAGCAGATGAGGTTCT
GCGAGTGCCACTTGCTGCAAGCCTGGAACCTACTGCAGCCGCCGTTTGACAAAGTCAACTTTACCGAGTACGAAGCACGCTTCAAGCTCTTTGAGCAGTC
GGTTGGGATCCTGGAAGCCGCGATACTCGACTGCCAGCAGAAGGTGATCGAGGGCGAGAAGGCGGCCGCGTGTGCGTTCCTCCAGCTCTGGTACCGCAAG
CAACTGGCCAAGGTGAGTTTATGGCAATGGCGTCTGGTTGTGTGCATACCTCTATAACGTGTAGCTATTGCATGTTGTCGGCAGCGTGGGTTCTATACCA
AGGTCGTCAAGATCAGTCGACACCATCGTGGGCTGATCCCGGGCATGTTCGACTCGACCCCCGGCCGCTCCAAGCTCACGCTGAACCACCGGACCAAGGA
CGCGATCATGGAGTTCCCCACGTCATCCTTTGAGCCATCATTTAAGTGAGTAGATGGCCAGCAGACCAAGGCACAACGCAAGCATGGGACGCTTTTGAAA
ACGCAAAATCGGGTATGGTATATTATCGTGTGTTTTTGTTTTTGTTGTTTGGTTGTGCTATCTTTCTCAAGGTTCACGCATGAAGATGCATCCGCTCCGG
GTACTGCGCATGATACACGCGCAGGCAGAGGCGAAGGCACCGATATATAAAGAGAAGCAGTGTGAACCACGAGACGTTATGCCACGCGTCCAGTCCATCC
TCTTGGTAGCGTGCGACTTGCGACGCGAACTCGTCGACGCGCGCTCATCTCTTGACGTCCTTGTTCTCTGGCTTCTCGAACATGAGGTCGAACTGGCGCG
ACTGGTTGATCGGGTTGCGCGCCAAGTTGGCCATGCGGAAGCGGAACTGGCGCCACGACGCGCCGGCATCGCCCTCGTGGTGAATTACGCGCTCGCGGCG
CTCCTTGTCAAAGTACACGTCCGGGTTTGCGAACAGGTACCGGAGCGCCACAGAGCTCGCGGCCACGGCGGCGCCGCTTGCGATGATCACGATCGGAAAC
GTGCCGCGGTCCGTGAGCCAGAGCTTGAAGACGTTGATGCTGGAGCGAGTGACCTTGGCCGAGGCAACCATTGCTGCTGCTGGAGTCAGTGGTGGAAGGT
GCTTGTTCACTGGGAAGGAAATGGGGGAATGGAGCGCTTGGGAAGCAGTTCAAGACAAATGAGCGAGCAGCATGGGCAGGTCGCTGCGTGGCCATGCGGC
GTTTTCCTACATCACTATAGTACGCAATTGGGCGAGCTGCTGCTATACAATCTACGCCACACGTGGCGAGCGTGTCTCTCGCGTGCCGTTGCGGAAAAAG
ACACGAAGCGCGTGCGCAGTAGAAATGCAGCAGGGCGTATATGGTGGCGGTGATGGGGATTGGTAGAGGATGCCACTCGTCCCTACAAACTTTCATATAA
AAGCGTACTGCAGTGCACACGGAGGAGAAGGCCCTGCAGAATGGAAATGCAACACCTTTTGGGCCATCATGCTCAAGTTGGTCGACCTCGATTTTAATGC
AAATGATATAGTGGCATGCCAGCTATTTGGTTGATAAATAGTGACTATCAGGGGTTGAATGTTCGTAACATCGAGTATTCTTTCGGATTTCCGAACCGTC
GCGTGTCTAGCAGTACGGCGTCATAGACAAACAGCATCATCACCACCAGAAACCTTCGTAAAGCGATAGTTGTCCAGTCCAAACAAATTCAAGAGGGTTA
ATGTTCCCACCTGCAGCCTTTTATAAAGTTCGATCTCCTAAACATCCAGTCCTCAGAACCGTACTTTACTGTGGATGACATCCAGCTTGTACATGCCACA
AAAAAAAAGAGAGCCAGCAGTGTGTTTTGTCCCACACCTGGGTAATCCCAATCGTACTTACTTACCTCTACAACCGCATACTCGATTGCCTCAGAGTGAT
CAACGCCAATCAAAACGCTCGAACCTGATCCTTCCACAAATAGAAGCGCACTTAACAAAAGTCTGCGACATGCGGATGCAGCACAAGTGGGTACACTTTG
TTAGTGACAGACACACCATTCGATATTATTTGACACATTGCCATTTGTTTACGCGTTGCACGGTGCACGCAGCACCACGCTGCCGCCAAGCGCTCCTTTC
ATACGATCGACCCGCGTCGCTACAGGAGCGATGGACGACAACAACGCCGACGAGCGCAACGAACAGATCCTGGGTGCTCACCGCCCTTGGAGCGCAGCTG
AGCACTCCCCCGAAACCACCGATGCAGCACCAGCAGTTCACTGGGAAGCGGCTCATTTTGCACACGTGTCGCAGCACGGCAAAGATGGATGCGTGGCGGT
ATTTTCCACCCCCGGGACCGAGATGCAGCTGGGAAAAGAAAATCCAATGCGCTGTGTGACATCCGACACCGTGATACTGGCGCCATCAGTAGCAGCAGCT
CAGACCTCGCGCTGTCAAACTCCTGCTCCTGCGGCCACTATAGGACGACGGCACCAAGAGCCAGAAGAGCAGGGAAGGGAGCAAACAGCAGCAGCGTGTG
CTTCCGAACCAAGCAAAACCATGGACACCAGCACCATTGAAAGCTGTACAAGCACCATGTCGCTCCAGGATTTCGAGAAGCTCGGGCTTCTCGGCATGGG
AGGCGCTGCGATCGTGTACCTCGTGCGCCATCGCGCGAGCCGAGCGCTGTACGCGATGAAAATGCAGCAGATTGCGCGGTTCGACCCGGAAAACCGTCAG
GTGCGTTAGCCTCAGTTGTCTGCTGAGTGGTGTGTGTGTGGCCATTTTCGCTCGTCTCCAGTACGTTCTGATCATAGTTTGCGTGTGTGGGAGGACAGAC
CCAACGAGCCTTCAAGGAGCAGCAAATCCTCGAAGCTCTGCAGCACCCGTTCGTTGTGCGCCTTCACTTTGCTTTTGAGGTACGTACATTCGAGGGCTTT
CCTCGAGAACACGATCTTTTCAGCTAAAGCTAATTTTCTTGTTGCAGGATGGCGAGAATCTTTGCCTCGTGATGGAGTTCTGCGAAGGCGGGAGTCTGAA
AGACCTGCAAGAGTTTTGCGGCGGCGCACTCTCGGAACACGAAGCGCTGTTCTACGCTGCAGAAGTCGTCATTGCACTCGAGTATGTACACACGATGGGC
GTTGTGTATCGCGACCTGAAGCCAGAGGTGCGCTACTGAAGAGGGCAAGCCATCTTTTCATCGCTCTTCATTATCACTTTAGCTGACTCATTTGATTTTG
CTGATTAGAACATCCTGCTGGGCAACGACGGACACATCCGGGTGACGGATTTTGGGGTTGCACAACGAGGTGATCCTATGAGTAGTGCAGGCACGGACGC
TGCAAGTACCACCAAGTTTCAATCTTTTCCTCAGTATGGAGTCGACGACCGCGTGCGTCTCCGTTCAAACTCGTTTGTGGGCACGATAGACTACATGCCG
CCCGAGATGATCCTCCAGAAATCACACCAGAGCACAGACCTGGATTGGTGGGCACTAGGCTGCTTGCTCTACGAGCTGCTCTTCGGTTCTCCACCGCTCC
GAGACAATGAGGAACAAGAAACACAAGATAACCAAAGCGATCCTGCGGCGCTGTTTAAGGAGATTATGAAGTGTCAAGTGTCCTTCCCAGCGACGCCGAA
AGTGAGTGACGCGTCCAAGGATTTGATACGCAAGTTGCTCGTGAAAGATCCGCGAAAGCGTTTGGGCCACCGAGTTGGCGCTGGCGAGATCAAACAACAC
ACCTGCTTTAAAGGAACCGAGTGGGCGTTGCTCGGCCACATGGAGCCACCTGTGGCCATCACGTGCTCAGAGACGTTGTGCTTCCAGCGATTCCGTCCAG
AGAATCTCCGTGATGACACCGCACGCGAACTTCTCTGCTTTGAGAAGCACCTCGAGTTCTCTACGTCCACAGAACTAACTCGAGCTTCTGCTGCAATGAG
ACAGTGGACTTTTCACCGCGAAAAAAATCACGTTGGTAAGAGTGACGACGAGGACTGCAACCAGCTTCAGATGGTCTCAACTCCATCGTCGATCTCGAGC
AGCGGCACGTTGGACGAGGATATGGACAGGTTCCTTGACGATCAGAGCCTCGCGTCGTGTCAATGCGTCTTCCATGGTTCCGTCAGGTTGTACCAGCGTA
AAGCGATGCCAGCAGCCATCGACGCGTCCAGATCCTTCAAGGATGCTTTGCGCCACCTCAGCGATTCTTTTCGTCAGCCATCATCTCATGATTCAAAGGA
AGTTGCGGTTGCGCCATTTTCACCAAAGATGAACACCACCAAGGATGCCCTGAAGGCTTGGAATACGTTCACAGACCGAGCCACGGCATTTCTGAGTGAC
CGCCGTTCAGCTTTGAGCAAAACCTAGTCTTTCAACTGAATCTAAGAACGTATTTATTGAACAAAATTGCGAACAGTCAATAGGAACAAGCAAGTGATCA
GGAATTCGAGTCCCTGGTCTTTGGTGGGAACCGCTCGATTGCCAGTCGCACGTGCTCGTTCTTCCGCACGGCGTGAATCGCTTCGTTTTGCGGATTGACG
CGTTCGAGAAACGCGATGCTGGCCTTTTGATGCTCATTCGCCATTGTCTCTTGCTCGGTCCGAAGGTCAAGCTGCAGTTGCATGAGCAGGAGCTCTGGTG
CTGGTACTTCGTGCTCTGGCGTATGCATGAGCGTCGTTATGGGCAATGGCGGTGCCGAAGTTTGCCAAATGCGCGCATTCATGATTCGACCAGCAAAATG
TGTGGGAGTTGCCTCTGTGGATCGCGTCAAACCGCTTCCGACGGATAGGATACGCGCTTCGCTGGCTATGAGATTGGATGGTTGCTCACCAGATTGAGGC
AAACGGAATTCCCTGTGGTCCACAACGAGACCACTTACGAACAGCGTACTGCTAAGCAACCCTGCGTCATTGCTGGCAGTAGCAACAGCGACATGAGCCC
ATTCTCCTGGATGAATGTGTCTACGCGGAAAGTCAATGACCAGAGACTGTGTGCGAAAGCGGACGCGCCAGGAGCTCTCTTGGTGGCCTCGGACGAGCTC
CAGTTGATGCGAGTCTTGCCAATCCAGCAGCACCATGTGAGTTCGGCTGGGTTCGTTCGCGGAGTTGTCGGGCAGGATGTTGATCCACATTTCGATCGTC
AATGCCGTCGGCGTCCGCGATTGTGCACGGATTTCAAGATGCAATTTGGAGTCCGAGCCGAATTCAAGTGCTGATGCAAACGCGACTCGGTCGTAGTGAG
CAATCGCGTTTCGTGCTGCTGTGTCAGCAACCGCAGAAGGCAACGCACCTCCATTTTCTTTCTCCACGCTTTCGGTGCTGACTTCAGGTCTCTCAAAGTC
ATAAGTCGGCCGCTGTGTTAGCGTTCCTCTCACGGCCGAGACTAGCGCTTCGAGACGCATTTGCATCGACAGCTTGCACTTCAACAGCGTCATCACGTAG
TACAGTGACGGCTCGGTCGAGCGTACGAGTTCATAGTAGAGACTCGCTTTCTCCAGCGATCGCGTTGTCATCCCGAGGCCATGCTCGTGCATATACCCGA
TGCTAAAGAGCGCACGAGCGTGTTTCCCGTTGCTCATTTCGTCTGCACGCTCATACTGTATCATCGCCAGCGCGTGCTTGCCTTCATAGAACAGCAAATC
GCCGTAGCGGACGGAGGCATCGGCGCTTTCTTGGGCGACGCCACGGAGAACGAGTCGGCGGTACATTCGAGTTTCCACCGAGACGTTTGACTGGTTTTCG
TAAAACAGCCATTGCGAGAACCCCGGGCGCGCCAGGAGCCATGCGGCGTTGCTCTCAGCGACTTCGTACCCCATCTCGGCGGCGATCAAGTATAGTTTCA
GCGCATGCTCACGGTCTCCGTTGAGAAAGGCCGTCGCCGCGGTTGCGAGCAGCTCCAAACCTTCCTCCGACTGCTCTGCGACCTTCTTGTACAACTTCAC
GATCTCTTCACAAGAGCTAGCTTCAGCGACTGCATCGCGCGATGTTCCTGCATTGAAAAGCGACGAGCGCAGTCGTGCTCGTTCTTTGAGTCGTGCGAGC
TTGAACGTAGCTGGGAGGTGGCCGACATTTGCTGACGCCTCCAGGTAGTCTTGAGCACGCTGAGGATGGGACTGCGAGAGCAAGAGCCCGGTGTTGTACA
CGCCGTCGGCATGACCGCTTCTTGCAGAGACTTGGAACAGCCGCATGGCGCGCTCGTAGTCCACATCAACGTCGCCGAGTCCGTGGAAGTAGACGGGGCC
GAGCCCGTTTGCGGCTTCGGCGTTTGGTTTGTTCGCGATTGAAGACTCGTTCAGCGCTTCTTCGTAGAGGCGCATTGCTTCCGCGACATCTTGTGGGAAC
CCACGAATTCCGTATGCGTAAACGTGGGCGAGCAAGGCTTTGGCCGAGAAGCTTCCGAGCTGAATCGCGCGCTCCAGGAAGGCCTTTGCCTCCAGCGTCT
GGTGCTGGTCCAAGGGGTCGACTGCTTCTCCGTGGGGAAAGTCACTGAAGAGCACGACGCTCGCCGCATTCTCCAAAAGCACTGGGTCTGAGGATCTCCG
CGCTCGCTGCTTCAGGTACTCCATTCGATGCGCATCATCCTGCTCACAGGGCGGTTTGCTGTGTGCATTGTCGGACAGACGAAAGGGCCTCTGGCTGGTG
AACATCTGGATCGGGTGGCGTGTCCTCGCAGCGTGCGCCGATTTCACGCGGTCGGCTGCAAACTTGTAGTGCTTGAGCGCCTCATTGCAGGATTTCTGGA
CCCCAGCGCCACGGAGATGGCGATACCCGAGGGCCATCGACGACGCGACCGAGCCACCCCGGGCGCCAAAGTGATGGTACAGGATGGTCTCAGCATCGTT
GTCATGAAAAAGGTTGTTACCGCGTGCACTGAACGTGGAGAGCGCAGCGAGAAGGAACTGCGCTCTCGAGGTCCCGAATTGGTTGGCGCTCGCGTGCAGG
TACTCGAACGCTCTCGTGAGGTTTGGCTTTAGAACTGGTAAATTGCTGCTTACACCAGCATCATTGCTTCCGTAGAGGTGCAGGCGTCCGAGTCCCTCGA
GTAGTTGACCTTGTTGTTGTCTCGGTAGCCCCTGGAAAAATTGCGACGACGATATCGCTTCGACGGGGGCATTGAGATCCTCAAGTGCTCTGAAATAGAT
ACGAAGTTTCCACCAACAATACAAAAGAAATCACGTTAGAAGGTCCATTGACCGCTAGCCAGGCTTATTGAAAGTGCCTCGATAAACGTACCTGGATGAC
TTTGTGAGGAGTTGCTGTAATGGCACCTCGTGTGCGACGCGGTGGCAATCTCCACACACGCAGAGCACTACAATGAGCAGCACGAGCAACGCAGCAACCC
GAGTAACATGGAGGACTCGAGGCATTTTTGCGCGCATTCTCGGTTCTCAGCCCAGCTTTTCTCAAAGTGGCAGTCAACAGGGGCAGACTGGGACCTTGTG
GTGGGCAAATCAAGGACGCGATGAGGAGGAGCAAGAGACAAACATGTGCAATGATCGGCGCCATCTGGCGAGGTGGACAGTTCATTGATGGCTCAGAAGT
GGAGAGAATTCAACCAGCCGATGGCATTAAGCATCGCCCTCTTCCACAAACGGAGGTGACGGGATGGCCGCGAGGGCTTTGAGAGTGGATTACACACTCT
ATGGGACATTCTGGTGCCGAAAAAAATGGCTTCAGTTGATGTGGTGCAGCCATATTATTACTGCCGTTGTACATACTGAGACTGAGATCGTTGGCGCCAG
AGACGAGAGTACAGCCATTTCCGCCCTGCCACAACCCTCGCACATGGTCTCTCCCCTCTCTCTCTCTTCCACAGCGTTGGCTGATGCTCTCTGCTTGCAG
CCCACGCGTCTGTTTGTTTCTCGCCTGCTGCCAATGAGCACTCTCCAATCTGAAACTACAGGACAACGCTGTAGTACGAACAAAACCCTCACGAATTTGA
CCTCATGGCTCGCGGAAGCGAACGACGATCTCTGCTCGATGGCGACATCGTCAAGCGCGAGCGCACCGCAGGCGAGACAGTGGACCTCTTCTTGGCCAAG
CTCGTCGACGCGTTCAACTTCCAGATCCAGGAGCGCTGCCTGGAAGCGGAACTAGAGGCGGCTATCACTCGAAACACAAGCGACGCGTACATCGCCCACG
TCAGCTCACGAGGTGGAGCGGCCCTAAGTCAGCAACAGGATAAGCAGGTAAATCCGTTTATGCGAAGCGTGAGTGAGAAACTCACAGCGTTCCTGTTGAA
CGCGTCGATCGACGACACGCTCCAGGAACACCCCATGGAGCTAGGTATCAACAGCAAGCAAATGCCACCAGAACGCTCGTCGTTCTCGTGGTTGGACCGC
GTCACGCTCTCATCCGAAGCCGACCTTCTGGACAAGGACGACGACGTGTTTTTTTGCACCGACGACGAGTCCGAAATGCTCGCAAACTACGAGACCATGG
CGTACACTCCACAAGCACGTCGCGCTGGCACGAAAGCCTAGAAACGTATCGGTTTAAGTATAAAGCAACAATAAATGGAACGTGCTCATTACCCAGCCAT
TCTTACACGTTTACTTCTCGTCTGGGGACGCAATCGCCTCGCTGTCGTCTTCAGGAGCCTCATAGTCGTCAAAGCCCAGCACTTTGTCGGCAAAGCTCAG
CGCTGTGTACGACGCATCCATCGCGATTCGCCCGCCGTCATCGGCCACGATGAGCGCGTTCAGGCAGCTCCGGAGCTCCTCGTCGCTCATGGCTTCGCCC
GAGTGCAGCAAGCGCCGCTCGAGCGTCTCCCAGCGCAGGCTCGCATTCAAGACACTGCCCGTGAGCACTTGGAATGCGTGCTCGATCTGTGCCTTGCCGA
TGCCAAACACCGAGCGGTGGTTCACGTACAACTTGATGAGCTCGGGCAGCGTGATGGTCTTGACGGCCTCGGTCGTCTCAGTGAACTTGGAATACTTGAC
TTCGCTGCACATGTGTTGAATCTCCTGGTCTGTCGGGTAGAACCCGAGAGCGCGCATCACGTTCGGAATCTCGTGCAGTGGGATCGCCGCCGTGATCTCG
CGGCTCGAGGTCGCGTTTTCGCCCTGCACGCGTAGCTGCGCCAGGTAAAAGTAGTCGACGATCTCGTGGTAGAACTCGCCATCGAAGCCGCCTTCGAGCA
GCGACACGTACGGCGCAAGTGCGGCATCGTACGAAGTCGAGGCAATAGGAGTGCCATCGTCTCGTCTCGGCGTCGCTCCGGCCGCGGCTTCGGCAAAGTC
CAGTTGGTTCGTGTCGATCTCCCACATGTTGACGACCAGGTCACTCCCGCCAGCGGTCATGAGGAAGGAGCCGTCGAAGGACACGTCAATGTTGCTCACC
TCGCCTGGGTGTGCGATCAGCCCCATGGTCTTGTGCGGGTTGCCGTCCAGCGGGAGCTTGAGGAGCCCGACTACTTTCTCATGCGTGCTGTACGCGCAAT
ACCGTTCCGCTGCTCCAGAAGCTGCTGTCCTAGATGCAGCCCCCGGTGTGGCTCCAGGCGCGGCTTTGACGGGGATCGGCACGAGTCGATTGATCGGACC
CCCGTAGGACGGCCCGAGCGTCGTCTTGCGACAGGTTTTGTTGCTCGTGTTCCACTGTTTGACCTTGTACTCGTCGTTCGCGACGAGCAGCAGATCTTCC
TGAAGCGACTTCATCTCTGGATGCCAGCAGCACGCCGTCGGCGTCGCGCTCTGCTCGATGCGCACGGGCGACTGCGTGAGCACGATGCCGTCGAGAATAC
TCGAGCGACTGAGGCAGTACTCGACCATGGTCTTGTCCTCGCTCACGGACACGAGCAGCGGACTCGCGTCGCTCGCGCGCAAGAACTCCAGCCCCGTGAT
CGGCTTCGAGTGCGCGCGGCAGCGACCAATGTACGTCCATTCCGTGTCATCGCCGTCACCGCCACCATCAGCGGCGGATTTTGCACGCCACATGCCCATG
TACAGGTTCGCATCGACCGCCACAAAGAGACTTGAGTCCGAACTGATGCGGATGTCCGTGATCGCGACCTTCGAGAGCCGAAACATTGCGATGTCCTCGA
GTGTCTGCGCGTGCAGGATCTTGATCGCGCCGCTCGTGAACCCGACCAGCAGCTTCCTGCCGTCGCTCGAGAACACGAGGCACTGCGGGCGAAACTTTTC
TGGTTCAAACTTGCGCATCATGATCAGTCGCTTCGACGTGTAGTCCCAGAGTTGGATGACGCCCGAGTACGAGCTCAGAGCGAGCTGCGCGTACAATGGA
TGCGTTGCGAGCCCGTGGATCGCATCGTTAATGCCCTGCATGAGCAGTGTACCACGGCGTTTCTCGGCCTCGTGCTCGGCGAAGAGCGCGGCCGTCATGC
CGACAATGAACGCCGACGACGTCGCGACGATGAAGTCTGGTACGAGGAAGAACTCCTCGTCCTCGTGGCCGTTGGTAGTACTCGTTTGTTTGCCTGAGCC
GCCAAGGCGCCGCGCTTGCGCTGTGGTAGCAGAAGCCTCGCTTCTCGAGTCATCTTGCCGATTTGAATCACTGCTGCTGGCAAATGAGACCGACGTGATT
GCTCCGGCGTTCATGTCTTCAAACCAGGCTACGAGGCGAAAGTCAAAGTCGTAGAACCGCACGGCACCGTCACTCGAGCCCAAGATCAAGTACCCATCCA
TGTCGGCAATGAACGTGAGCGCGACCTTCTGCTGCAGCTCGGACCCGCCAGCCAAGCGCACGATCTTGACGGCTTTCCGGTCAGGGAACCGATTGCTGCT
ACTGCTGTCCGAGGTTGTGCTCGCGCCCGTGGCTTTGAGCATCGTGGACGCATTAAAATCGTCTTCTTCGTCGCCACGGACAGCGTCCCAGAGCACCAGA
TCGCCGTCTTCGGTGCCCGTGAGCGCTTGCTTGGAGTCCGGTACGAAGATCGACATGGTGAAGTCCCCGACGACTTGGCGGAAGTCCCGCTGCGAGAGCG
ACGGCGAGTAGAACAGCAGCCGCTGCTCTTGCCAGTTCCAGAAGATCACGCGCTGCTTGCCGTTCGTGACGATCTCGCGAATGTCGTACGTGTTGAAGCG
CACGGCATGCTGCATGTCTTCTGTGGCCACAAAGGATGAGTACAACGCCGAAGACGTACTCGCGGCTGCTGGCGCGGTCCATTCCCACACTGAGAGCTCT
TGGTGGAACCGTGGATGCTTTTTCTTCTGCGAGGAAGGCTGGTTGGTGTCGGATGCCGTTCGCGAGGTCGATAGGTCGACTGCACTGAGCGTGACAAGGA
AGAGCGCGTCGGGCGAGATGTCGATGGCCTGGACGCCGAACGGATGCGGCTGGAAGATTGTCTTGATCGGATTGCCCGTGATAGAGTCCCAGACCACGAT
CATGGATTCGTCGCCGCGGTCCGCCGTCACGATCCAGTGCTTGTCTTCGCTCACGACGCAGCACGAGATTGGGTGGCAGTGACCCTGGAGCAGCTTCTGC
TGCCGGCGCGAGTAGTCGTAGATCACGCCCGTGTGCGCCGATGTGTAGAAGAGTGCGCGTCGGGTCTCGGTCGAGAGGCTGTGCACGCCATTCACGATAT
CCTTGTTAAAGCCAAACGTCCACGCGAGCCGCAATGCGTTCTGGTTCGAGAAAGGACCCGAGGTAGGAAGAGCAATAGCTTCAAGGTGTCCTCCTTGGGT
GGAGTGACTTGGTGCTTTATCTGCGGCTGCGTTCGCATCGTGTTCCTCCGCAGCGTCCATCGTGGTGGCTCGTATGCGAAAATCAAGCACAATGTTCGCT
GTCTGCATGCGGAGAGCGCGACGGTTATTTCATCAACAAAAAAACATAATCTATTCTCGAGGAGATGCGTCACATTGCGGCGCATATTAATACCAACTGC
GGGTGCTCGACTTGACTCACTGATACTAGCGCAAAGCTCAGTTGTCGCCCCCACGTAATGTCAGGAAGACCTAACGCTTCGCGATCGAGGCCTCCAATGA
GTAAAGATCTTTTGTTGCAATGACACAAGAGTGTGAGGCTCTAGAGTAGTTTGCGTATTTAAGCTCGTGTGTTTGAGATGCTTGAAAAACCTGGGTAGAT
TACGAACTCAAGGGAAATACTATTTTTTCTATGTCACGTGAGGATCTTGGTGGATCCAGGGCGGCGGCACATGTTTTCCCACCGTCGATGGCGCACTAGT
GTTGTGGGGTTGCTCACCGCGTACCACGGCCCCGAGAACGATACTGCGTACAGCCATCCGTCGCAATCGCCTTTGCCGACATGGAAGTTCCAACCTTGAC
TTTGAAACCCGAGCGGTGGTTTTGCAGCGATCTCTTCAAACTTGGTAGCCGAGTGGGATCCGTCCTCGTTGCTCCAGCGTGTTCGATGGGAAAACAGGAA
AATGGACACGTCTGAACTCCAGCCGGACGAGAGGGACCAGCACTCGTTTTCCCAAACCTCGAGACGCACTTCGGTCAGGTCCAATGGCGTGACGGCGATG
CGTAGAAATACCTGACTGGGTTCCACGGTCTTGAGCGATGGCGGCACGTCCAAAGTGTACCCTTTCGATGGTGGCAGCTCTTTTCTGCCAGTTGTAGCGG
CATCTGGGAGAGCGTTATTTGTATCTTCCGTGATAAAGTCTTTCAGTGGGATGCTGACGGATCCGAGATGGTCGTCCCGTGTGATGAGGTCGTGGTCGAA
CACGTCGACGCGCACGCACTGCTCTTCGGGATTCAGCACCTTGAAGTCAAAGTGCTCGGGCGGATCCCATACAGGATCCAGCGTTGATGCGCGACAGGAG
CTCCTCGCCGATTGCTCGTCCACCGTGAATTTGATGTACGGGTCGCTCTTGCCGATGTAATCGCCCTGCGCGAGCCGCGTCGCGTGCGTGAGTGTCACTC
TCACGACGTGGGAGCAAGCCATTTGCGCGTGCCTTTCTTGGAGAATTTGAAGTTATGAGCTCGTAGGTGAATGCGCAAGTGATCCCTTTGAAACACCCTT
TTGACTGGTTTTCAAGGAGCTGCTCAAAAAGGTAGCCATTATCAGATTTTTCACACCTGGGCAACGTCCTCTGTCAACGTTGCGCGAACGTTGTCTGAAT
GTACACATGGTACGTGCCTGAAGATATATCCGGAAGGTATACTGACCAGTTCCGATTTCTACAAGTTCAGAAATCGGTTTGAAGAGAAACTGGCAACTGA
TTTTTTTAGCGCTGTAGCATGGGTTATTATTTCTCGAAGGCAATATTCAACTTACGGGGGTAAAACACAACACAAAGTCCATACATTTTAGTACACATTA
ATCGCGAATCCCTTCATTTGCGACGCACGCGCGGCATCTCGTCGTCTATTGGGGCAGCGCTTCTCGCAGCAGCAGCACAGTGCGCGTGTTGTTCTCTTTG
TTAGCGAACAGCGTCATAGCAGCGCCGGAGAGATGGGGTGGTCAAAATACGATGCGCCTGGGATCGCAATGTTTTTTTCTTGTTGTTGCTGTTGTTTCTT
TTCTTTTGCGGGCTTATTAAAATGCTTGCTGCTCCACTTTCGAGCCAATGGGTACGCAGTGGTTTTCCCATAAACGGCGGCGCACAAAGTGCAATCGGCT
CTTGGTCGACGACCACGGACCCGCCCACGAAGTCGCGTACACCCATCCGTTCATGTCCCCTTTTTTCGCGCAGTACTCCCAGCCGCCGCCCTCAAGATGG
GACGGAACCAGCGGCGCAACGTCGTTGAAATGCGCCGAGCTCTTGGACTCGTCATGCGTGCTCCACTGCTGGCGATCTTTAGAGTCGGCCGCGCTCCAGC
CGGATCCGATGGACCACGTCTCGTTCTCCCAGATCGTGAGCGTCGTGTCGCCGTCGTCCTCGTTCTTCAGACAGATCTCCAATTCAATCGTACTCGGCCG
GTCCTGCTTTGCAAACTCCGCGGGCACGTCCAGCGCAAACACCTCCAAGAACGACTGGTCCATCATGTTGGCAAATCTGGACAATGGGATCACGAGCGAG
CCGAGCAGGTCGTCTTGGTTGAGGGCATCGTAGTCAAACACCTTGACGCCGAGGACAGCGCGGTTCACGTCCTCAATGTCGAAGCGGAAGCGCTCGGCGG
GCGACCACACGGGGTTCAGGTTGCTTTTGATGCACGCGCTCTTCTCCTGCTGGCGCTCGACTTCGACGAGCACGTACGGGTCGCTCTTGCCGCCCATGAA
GCTGAAATCGCTCGCCGCGAGGTCCGTCGCGCGGTGCAGCTTGACGTACAGCACTGGCATTATTTGTATGGAGAGGGGAGCGAGGGCGGTGTGTGTGTGC
GCGTGCAATTATGCAGTGCGCTTGAGCCTGCGGTTCTGTCTGGTCCCTCGGGTGCGCGCTACGAGTTGAAATGCGCTCTTGACGTTGCATGCGGGCTGTT
TCGTCGCCTGAGTTGTTGTTTATTGCGCGGGAAGATCAATACGGACTATAGTCAATTGTGACCTCCGTACGATAAGGACGCCTGCCTGGTACTTAATGTT
TGCCAGCGCACTTGAGACACTTTAATGAGACAACTCGCGCGTCCTTGAAAGCAGGGACCATATGGCTACATGGGGGGAACAAGTGCGAAGGCTTTTATTT
GGAGCCTCTAGATTTTCCACCCAGGTTCAATTGGAGGAGAGAGCGATTTGCTCAGCAAAATCCACCGAATGCAGTTCGGACTTCTATTTATTAGTGTTGC
CAGACTCTAGACTTGAGAATTGTATGCTTCGATCGGTAATACCGATAGACGGTTTTTCAACAACTGTGCACTCTGAAAAAGCATTTTTAGAAGTCCGGAC
TGTGATCTGCCCAGCGAAATCCATTGATTACATTCACTATGCAATCACGGGTGTAATGAGGACAAGTGCAGGTAGACGCGACGGTGGCTATTAGCCTGTC
CGAGTGGTGCAGCTCCAATTAGACCAATTAGAGAACTTTCGGAGGTCCTTACAGTTTAGTTTCGTTTTTAGATAGCACGCGTTTATGCAAAATCAATGTG
AAACTGAAGGACAGCAAAACAACGGTTTCGAAGACTTGTGTGGGATTTCAGCACAGATGCAATCTCGTACCTATCTCATTATTGAAAGTGTATTTGCGAC
TCTTTGCTTGCTCGGGATAATCTCACATTTCCTCGTACACTGCGCGATCATGGCTCACAGACAACAGCGACGCTATCGAAGCAACCAGCGATCCAAGAGC
TGCCTCTGTTCACTTACCTTCTCAACCAGCATCACCCAAGTACATGCAGAGCTGTCTTCCAACTCGGGGCTTGCGCGGCACTGCTCCGCTATGTCGTCAA
ACACCTTCATGATGCCGTTCGACGTACCAACAGGAGCTCTCCAGGGCCGATATGCGCTGACAGCTTTCAATAGGATGAGGTCGTCAACGGGAGCAAACTT
TTTCCGCGCTCTTCTAGGCTGGGAATGGGTTGGTGCGCACCATTGCGCACGGCTATGAGCAGGAATAGAAGCCACGCACCACTTGACCCAATCGTCTGCC
ATCATGGCAAACGCTACCTTCACATCACATCTCATATGTAATTTGAATGCATTAAGGCTAAGTACGTGTATTCAGTAGCTGCGAACTTGCGTGACTACCA
ACAAGTACGGTGTTGATGCGCTAGCATCATCAAACGAAGCGATTTCCCCATCATCGTTCCCATTAATAACCTCTGAAACCTAAACTTTATATACTTTTAC
ATCAACCACCGTACTTCCATTTTGCTACTTTCTGCACATTTTCAACCACTTCATTATTTTGTATAACTTGATACCCCGTTGAATCCGACCAAACTATAAA
AACGTGGCGGAATTCTATGTCTTCCCATTACGATGGTGGGCGATGAAGCATTGCACTACCTGGCTTCCGCATCATAATCTGCGGCTCTCAAGCGACCGTA
AACGCGCGCGTGCCTCTCTGTTCTCTCACTCGCTTGCGTATCTATCGCTGTCTGTGATCGTCACCCGCGCCATTCATCGAAATCGCGTGGTGGCCAGGAG
CGCATGTCGGACGGTGTCATGTCGGCCGTGACGTGGGTCGCCGTGGGGCTCGGCGTGGTTGTGGTCGTCGGCATCGTGCTCATCGCGTACTGCTGCTGGT
CGCACGGAGACGACGACGAGACCGACCCGAACACGCTGCTGGATGGGCTGTTGCGCCGCGAACAGCTCGAGGACACGATGCTGGCGGCTGGCGAAGACGG
TGGCTGGCAGTGCATCGTGTGCGCGTACTCGAACAACGACAAGCACAAAAACTGCCTCATGTGCGGCACGAGCTCCGGGTTTCTCATGACGTCGGCGTTG
GTGCGTCACAAGAGCTCCGGCACGCTGCTCAAGAATGATGAGAGTGTGGACGATCAGGAGAAGGCGCGTGCGCGCCAACGCGCGTTGTTCAAGCGCCGCA
TGAACTCGATGTCGATGCGCAAGGACCTCTCGCAGCGCCAGCGCGGTGCGATCCGCCGACGCCTCTGGGAGCGGAAGCAGGACGCCGACGGCAAGTTCCA
CTGGACCCGACAGAACAGCACCGACACCTTCAACGACACGGCGCTGTCGGGCAACTCGATGATCCTCACGAGCAGCAACCGCGGCGCCGCTGGGAGCTCT
CACGGCATGCAGGTCAAGGGCCCGCTCGAGAGCATGACAGACTACCACAACCTGCGCTCGCAGGGCTTTGTGTGGCAGTACGACGACCTCGGACGCCTCG
TCTGGAAGCAAGCCGAAGATGGTAAGCATCTTAGTGCTGCTCCTTCTTTTTCTTGTAAAGACGTGTCCTCATTGTATGTGTATTTTGTGCAAAACAGTCG
CAATCGACATGGAATCCTTTGGAGTAATGAACGAGGGCAAGGAAAAAGCCATTGACTTTGAGGTGAGCTCTTGGACATATACAAAAGAAGATATGTTGGT
GTGCTTGTGTGATGCTCATTTGTATGTGAATGTTTTATTTTTTTATTTTCTTTTGTAGGGCATCATGGCGATGGACTTTCGTGTTAAGAAGCAGTGGTTC
CTCGTGCACTTGGCGCAGATCGCGACGCCTGTGAGCAAAGCTGTCTCGAAGCTTGGTGCGTATCCTTTACTCATATTTGTTTCTGCTTTTGCTTAGACGT
TCTCAACTAACGTTTTGTATTTGTCCGCTGCTCCATTACAGCTGTGACGCGTGAAAACCTTGTGCAAGAAACGCTCATGCGCCTCACGACGGCGTCCCCG
GAAGCGTTGCACACGTACCTCAAGATCACGTTTGCGGGGGAACCGGGCATCGACGCTGGCGGTCTCTTGCGTGAATGGTTTGGCATCATCTGCAAAGAGA
TCTTCAGCGAGAAGATGGGGCTGTTTATCCCCACCAAGGGGGAAGACATGAGTTACTGGATCGATCCGCTCTCGGGCGAGAAGAACAAGAACCACTTGCA
GTACTTCCGGTTGGCGGGTATTCTCATCGGCAAGGCGCTCTTCGAAGGCCTTGTGCTCGACGTTCACTTGGCGCTGCCGCTGCTCAAGCACGTGTTGGGC
ATCCCGATCTCGTTCTCCGACTTGGAATTCCTCGATGAAGATCTTCACCGCAACAGCAAGTGGCTCAAAACGAACACGCAGGTGGAGAACCTGTGCTTGA
CGTTCAGCATCATGATGGAGAACGGCAAAGAAGTGGATCTCAAGGAAAATGGGCGCAACATTGACGTTACAGACGAGAACAAGGACGAGTATCTCCGCTT
AGTGCTCGAGTACCGCATGCTCATGAGCATTGCGGACCAGCTCCAGGAATTCCTGTCAGGGATTTACGACGTCGTGCCCAAGGGCTTGCTCTCTGTGTTT
GATTATCAGGAACTGGAGTTGATCCTGTGTGGCATCCCGACGATTGACACTGCGGATTGGAAAGCGAACACCAAGGTGCGGTACTATGTCACCGACGACG
AAGACCGCAAGCGTGGCGCTCCTGTCATCTCGGAAGAGGCACAGAACTCGGTCTTGACCTGGTTCTGGATCGTCTTGGAGAGTTTCACGCCTGAGGAACG
CGCGCGGCTGCTGCAGTTCACGACCGGCACGAGTCGCGTGCCTGTGGAAGGTTTCAAGGGGTTGATGAGCTCGAGCGGCATCATCCACCCGTTCACGATT
CAGTTGATCAAACGCGGGAACGACACGTCGGATTTGTTCCCGAAGGCGCACACGTGCTTCAACCGGTTGGATCTCCCGTTGTACCGCTCCATGGACGAAA
TGGAGACGTATTTAACGATGGTGTCCCAGATGGAGATCATTGGCTTTGGCTTGGAGTAAGCGCTGCATACCTGTGCATGAGAACAAACGAGGCAATCCAC
CCTCAAGAAAAAATAAAATGAATGTGCGCGGCGAAGTGGTACGCACGATGCCACAACACTGCTGCTGTCCTTGAAGCTTGCAGCAATGTCTCCCACAAAG
TGGCGTCTGCACGTACACAATTGAATGTTAATCTATTGCATCTATCGGTTGTTCGAATGACTTGTTCTTTATTTCTCGTTTCCGGCTCCGGCGCGCGCGG
CTTTGAATTCCTTGACATCGTGCTGCAGCAATTCGCGCTCGCGCTGTTTCACGCGCTCGTTGATCCCGCTCTGCGCATCGTTTTTTGCTCCCGATTGTGG
TGCTGGCGCCAGAAAAAGCGCCTTCTGCTGCTCCCAGTCAGCAGTCGACGTCGGTGCCTGTGTCTCGACATTATCGGGCGATGCTGCCGCTGATTCCTTA
TTGCTACTTTGTGTGTGTGCAGTCGCTTTGGCTTCGGTCACTTGCTGCTCGAGCGACGCGATGCGCGTGCGCATTTCCTGGATCATGCCCATGAGCGCGA
CGTCCTTCTGCTCGCGATCGGCTTCGCCGCGCAGCTCGTCCTGGATGTGCTGAAGCCGCAGCATTTCGTCCTCGGCCTCCATCTCCACCTTGACCCTGTG
CAGGTACAGCGCGAGCAGCGTGCCCGGCGTGAGCGCGAACATGGCGTACCAGAACTTGCGTTTCGGCGACAACAGGTTCCTAGAGAAGACACGTACGCAG
GCGATGCACACAGAGAGAAAGACAAGGCAGGGCGTCAGTGGCGCTGACAGCCATAATAGAAACCATAGGAGAGATAGATGGGCAGACGTCCACGTACTCG
ACGGCGCCCGGCGGCGCCTCCGAGAAGAGCTGCTTCCACATCGACATGGCTGCTCCAATATTCACAGGCGCCACAGACACACAACTTTTGCAAGCGTTTC
CACTAAGTTCGGTTTCTGATGCGAACTTTACACTCTCCATGGTGGTCACGCAAAGAAAAAAAGCGAAGCGCTTCGTCCACATATCTTGGACAAAATGAAA
GAGCTGCCTACGTTGTAGCGCATGCGCGCTTTGGCGTTTGTTTTCCTCCCGTTTTTTCTATTAGTATGGTGTTTGGGTCTCTAGTGTATAACACACGGGC
AAAAGCAAGTGCTTGCTACGGTTCCCTCACTCCATCTCGTCTCGTTTTCTCTTCTCTCCAATTCTTTTTTGTTTTGTTTATGCGTTGTTGCTCTTTCGTC
ACCTGAGTCACAAAAGTCCCCATGGTGATTCTGTTTGTGTGTGTGCACCGCAGTCGGCAGATGCTTCTCTGCGGTCGCCCATCGTTCGTTCTTGCGTGGT
TCAGCGTTCTGGTCTCGATCCCCCATTGCCATCGCGCTGTTTCACATTCATTTTCACCTAGTGGTTCTTGTACACAAACTCGCGTGTCGTCCACGCCGGA
CCCGTGTTGTTCGTGTTCATACAGTTGAGCACGAGGCCGCGGATTTCATCGGCGCGAGCGCGGTCTAGGGTGCGCAACCAAATCTCGAAACGGTAGTTGT
TGCCTGGTTCCTTCTTGTCGCGCTTGTTCTAAAAGAGTCAATGCAAACACACAGCATGCAAGTCAGTATCATGGCGTCGCCATAACCCCCACTCAAACGA
TTGCTTCACGACGTACTTTGTGAATCACGCGCACGCCCGTGATTTCGTTGCCAGGATCGATGGTCTCGCCAATGGCACCTAGCACTAATTTGTCCCAAAA
CTCGTCCAGCGCTTCAGAGCCGATTTCTGTTGCATGTCATAACGCAAAGACGCCCTTAGACATAACTGTATGCGTTCAATACATAAGCAAAAATCATCAC
CACCAGTCATTTACCTTTGCGGATGGACCATTCGCCGCCTCGCTTGTTCTCTGGGTCTTCCCATTCCGGTGTAATGCCATCCTTAAACACCGCAAACGAC
TCCACCGTGCGATCGGCAAACTTCTTCTTCGTGAACCCGTCAAAGAGCACTTGACTATTCGTGTGACAGCATACAATACACATTTATAGACAACATTAGC
GCATTTATTTTCCATTTGCCAGCCACCATACCATATTGGATACGATCGTATCTTTCTTGGCTTTTTGCATGTTGTGTGGTCGCATACCTTGGCTTGGGGA
TGTTGTTCCAGTACGCCCAGAACTCCTCCACCGTGCGAAACGAGCACAATTTGAACAGCTTGTCGCCGTATGCCATGCCTTTGCCCAATTCGCGCTGCTC
CCAGATGGACCAGCCCGTGTGCAGCTCGTGTCGCTCGTCGTCGCCGGACGCCATCGTTGTCTTCTTGGTTTGGTTTTGTTCTTGCTGTTACGTTCGTAAA
ACAGGCACTGCTTAAAATGCGGGACTGTCGTACAGGCGCGGGATGATGGAGGTCGCGGATATGTACACGAGGGACCAGTTATGCTCACAGACACACGCAC
GCACGAGACTCGCACACAGACACACAATGGGGGCGGAAGATGCGCGGGAGGTGAGGAAATGCTGCCTCGTGGGTTTCTTTTTTGCGGAAGGGGAAGGGTG
GTCGCCCCGCATACGATCCAGAGGCACCGGTTCCATACCGGTATAATTGACGAAAGTAGCACGAAGGTTGCGTATTCTCATGACGTTACTTATGGATTTA
TCCGTATTCTATTAAACACTATTTATGGGATCGTATCGTATTTGTTTCAATTACCTTACGAGTTGTTTTGTGTGTGCGTGTGTACCCATTTCACATTTTC
TCTCTCTTGGTCGTGATGGTGCGCGCGAGCGTCGTGCGAAGGCCGCCCAGGTTCGCCTTCATGCGCGACCGCGCCGACAGGGTCTCCTCTTCCTTGGAAG
CGCTCCCGCGAAGCCACGTACTGAGGATGGTGTCGAATCGCTGGAAGCCGTCGAGGGACGTGAGCTGGAGCTTCTGACGCCACACGTCATTACTGGAATA
GTACATCAGTGGCGGCGGTGGCGATGTGGTTGCGCTGCGTTCCTTTGAGTACGTTCGCACGAGATGATCGTCAGAAGCGCGGGGAGACAGCGCTCGCTTC
AGCCGGTGGTTGTACTCGATCTCCAGCTTCGCGCTCCACGTGCGAAGGTACGCGACGCCGTTCTCGAACTGCGCAGCGAGGATCTCGTTCATCTTGGCAT
TATCCACGACAAACTCTCTGTCAATGAGCAATAGCGCAACAAAAAAACATTCTCAGTCAGTCAGTAGCATACACGCTAGCCATTTCGATTGTGTCACGAC
ATACTCGATCGTGACGCTGATGCACGCTTCCAGGACTTTGGGGAACAGATACACGCGAGACGGTGACGGGGACGCGACCACGCACTTGCCGATCGGATCC
AGCAGCTGTAACACCAGGAGCTCCATAAATTCAGTCTGCACAAGGGAAAACGATGGCATTGCACGGTCAGTGCACACACCACAAAGAGATGCGGCCAAGG
AAGGCAAATGATGCAATAAAGTTGGTTCCAGGCGTATGACCTACAGCGGATCCTCTCGACTTGGACATGCCTTTCGACACGAGCGGACGGCACAATCGGC
TTGCAGCCTGGACACACGTCGTACGAAATGGTTAGCACCACAAATTTATCGGAGGCAGCGAGATCATTAGTGCTGCCCCAGCATGCACATCCCGCCACTT
TACTATGGACATCGTACCAGCTCAGTCGTCTCGAGAATCGATTCCGTGAGCTCTGCGAGCCGCGTCTTGAATTCGGCGTACACGAGTTCAAACTCGAGCG
AGATCTTCGAGATCTGCAGAATGTGGAATGGCTGGTTGCCCGCTTGAGGAAACACAGACAATGACGGAGATAAGCCTGAGATTGCAGGTGGTGCTGCTGC
GGCGGGTCTCGATTGCCAGTGGTGCTGTGCGCCCGCTTCGATGTTTTCGTTCGCCTCGATCAGCGTCGAGACCTTCTCGCATGCCACCGTGACGTTCATG
AGTCCATCGTGGAGCGCGATCATGCTCAGCAACGTGCTATTATTGCTGCCACTGTTGCCCGAAGTAACGCTTGCCGCTGTTACACGCGGACTAGTGCCTC
CACTCGCATTGTACACAGTCGATGACGACCACATCGGCCGAGTCGCGATGATCCACGCGAGATATTTGCGCAGTGACGGCAGCAAAACCGAGAGCAGCAT
CACAAACGGACACACTGCTAGCGCACTGTTGTTGCCGTCGTCTGGATTGTGTCCCGTGGTGTCCTCGAGCACTTGCGTGATCCCAGCGAGCACTTTGGAC
CCCAACTCGGTGATGGTGTCTTCTTGGAAGTTGTCGTGGACCGGAAGCTGCAGCCTGCGATGCAGTTTGCCCACGAGTTGCGCGCACTGGCAGTAGAACG
CCGTGATGCGCGGACTTCGGCGCTGGAAGCTCGTCGCGTTGACCACGAGCGGGCTCTCGAGCACTTTGACGCACGAGGCACTGCACGGGACGTCGTCCTC
ATGCGCGCACAATTCGCACGTGGAGCCCTTGCGGGTGCTGCTGCTACTTGACGACACGCCGCCGCTTTTTTTCCCTTTTTTCTTCTTCTGCGTCCGCATG
GCTCGTAAATGTGCGTTGTTTCGTCAAAGCAAACACTGGATTCACAAGCGAGTTAGCGCTCACGCAGTACACAGCAACAGCACACAATGTATCAAGGCCA
TAACAGTCTTCATGCTCTCAACGCGTTACGGACGTTTACTTTCATAAATATAGCGCATTCCCAAACCTTCGAAACACCATGAAACACACACACTTCAATA
GAAGGTTTTGTCACTCTCACTAAACGTTGTCAAACGGAGCACACAAGCAATCACACGAACGACATAGTCCCACCATACTTGAACAGCCAGTGTCGAAGAA
GGGCGTCGCACTAGAGTTGAAGGCCAGTGTCGTATTGCTGCGCTTGCCTTTGAGGTGGTGGGGGATTCTGAGCTGCTGCTTGTGCTCTTTTTACTCGAAA
CCAAAGCCCGTGATTTCCATTTGGATCACCTACAAAAAATACACACAAAACGACAATGTGAGTCAAGCGATTTCAGTGGCGACCAACAAAGTCCTTCTTT
CCGACGTACCAGAGTCAAATACGTGACCAGATCTTCCTTGGTCTCATACACGGGCAGATCAATGCGGTTGAAACAGGTATGCGCACGAGGACACATCCCG
AGCGGCGGCACGCCTGGCGCTACGAACTGGATACAGAATTGGTGCACGTATCCGCTCGCACTTGTAAGTGCCTTGAAGCCTTCGACTGGGACCCGCGCTG
AGCCTGTCGCGAACTGCAGTAACCGCGCACGCTCCTCGTCTGTGAACGACTCGACGACTTCCCAGAACCAGAACACGACCTGGATCTCGCGCTCGATGGC
CGGGATGTCCGAGTCGCGCGCGAAATTCAGTACGCGCGTGTTCAGCTGCCAGTCCTTGACGTTGATCATGGGGAGACCCGAGAGGAAGAAGTCGAGCTCC
TGGTAGTCAAACACACAGAGCATGCTCTTGGGGATGATCTCGTAGAGCCCCGCGAGCATCGCCGTCAGTGGCTCCGCGACGGAACCAAGCATGCGGTATC
GCAGCATGAGCGCGAGGTACTCCATCTTGTTCTCGTCGGTCACGTCAATGTCGTTGCCGTTGGGCTTCAACTCGATAATGTCATCACCGTCGCCCTGTAC
GCTGAAGGTAAGGCAGAGGCTATCGACGTTGTCGTTCTCGCGCATCCACACGGCGCTCTTGTAGACCTCTTCGTCGAGAAACTCGAGGTCGGAAAACGTG
ATCGGGACGCTCAGAAAGTGCTTGAGCAGCGGCAGCGCCATGTTGGCGTCAAACACGAGCCCCTCGAGCATCGCTTTGCCGAACAACCTTCCCGCGAACG
TGTAGTACTTTAAGTAATCGCCATCGCCGTCGTTGCCCTGAGCTGCGCGCTTGCGGCTGAGCGATGGGTTGATCCAGTAGCTCATGTTCTCGGCGTGGGT
CGTGCAAAACAGTCCGCGCTCCGCGCTGAAGAGCTCCTTGCACACCAATCCAAACCACTCGCGTAGCACGCCGCCGGCGTCGAGAGCTGGTTCACCGATA
AACGTGATGTTGAGGTGCTCGCGGAGCTGTTTCGGCGTCAGGTACCCGCCTAACGCCAAGACCGAGTCCTCGAGAATGTGGTCGCGCCGCACCATGAGCT
TGTGCACCGACTCCATGTACGGCACGTGGATGCTGCTCACCTGCTTAAGGAACCACTTCTTCTTCTCGCGGAAGCTCATGGACATGAGCCCTTCAAAGTC
CACGTCAGCCGCACCTTGAGGGACTGTCTTGTCGCCCGTCTCGACCATCACACCCGCGCCTGTCGCTGTTGTGTCTCTTGCTGGGTCCATCTGGATGGCC
ACCGAGTCGGTTTTCCGCCACGCGAGCTCGCCGTCGTCGTTCATCTCGGTGAAAAATCCCATGGTGGCCGCGTTCTTGCGGCGCAACTGCTCGGCGACCG
TGCCACGCAGCGCGTTCGCGTGCGGGTTCTTGGTCAGGAACGTGTTGTTGCGCAGCTTCGAGAGGAACGAGTCGGATTTCTGAAGCGTGGGCTGCGTCGT
GCGCACCCACACGAACGCGCCGTTCGGGAGTGACACGCGCTGCCAGAGTCGCCTTCGCGCCGCGCCGCGCTGCTTCTGGGTCAACTGCATCTGGTTCAGC
CGTCGGTACCGCAGCGCACGCTGCCGCACACTCGTCGTGAGCTCGATGCTGTCTGCGGCTGCATTGGTCGCGCTCGACGAGCTGCGCAGCAGTGGGATGT
CGCCCGTGGCGGAGTGCAGGAACGCGGTCTCGTTGGTCAGGAACGTCGTGTTGTTGTTGTTGTTATTGCGCAGCACGGTGGTAGTGAGGCTGCCGCCGCT
GAGCAACATGCTGCCGTTGAGCAGCGACGCGTCGGCCGAGGCACCGCAGAGCGCGCACGTGGCCTGGTCCGGGTGGTTCATGTGCATACACACGACGCAC
TGCCACTCGGTCTTGCCGTCCTCGAGCACCGTGTCCACGAGGTTCTCACGCAGCAGCAGGTCCCGGCCATCGATCATGTCGATGTTGTAGCCGTAGAGGT
CATCGTCGGCGCGGTCGCGGCAGTGGCGCGCACACGCGATGATGAGGCAGAAGAGCACGAACACGGAGCCGCCCATGCAGCCGAGGATGATGTTGATCCG
CGTGCCGTCGTCCATCTCGCGCTGCTGCGTCGTGTACGGTAGGGATATAGCGGGAGCTGAATGTGGAATGGCGCCCAATAATGGGGGGAAATCTCAAGGC
GGGCGCAGCGGATGGATGGATGGATACGGGGTTGATATGGAGACGCGCTGTCCTCTTCTTCGTCTTGTATTGGAAATAGTAGGAGGCGACGGGTTCAAGT
GCACTCGTCCGTTGGGTTACAGCCGCATGCAACAAACAGGACCTCAAAAGAAAACCTGTGATGTCGTCACCTGGTAAAATGGGTCAGTGGGATTAAAGAG
GTTATAAAAAAACTGATTTCTGCGGTGTGGATATCGATATAATAGATCTTTTTTGTGGGTGTAACTGATATAAAGAGGGTGATGAGCGCAAAGAAGGAAG
GAAGTTGCACGCAGACACGACATCTGTCGTGTTGGCGAGACTGAGACTGACTTTGGCAACGTGTGTACGAGCGGACGCCATTTTAGCCAATCACACGCGA
GCATTTTGCATAAAGCTGACCAATTTTTGGAAGATACCAGTTGCATCATATAGCCTACGAGCAGTCTATTCTATCAGTTCAGATTTACCCTGTTATCACT
ATACCCTATCATTAAAAGAACCCCAACGCTACTGTTCTTTTGGGGCGGTACAGCGTGCCAATTCTTGGCAAAGAGAACTACTCAGTTTAGTCGAAGCGGT
CGCATTGTATTCTCAGCTCTTCTCTTGTCTTTCTTTCTGCCTGTCTTCCGTGCGAGCGCGTGTTCATTGTGTGTGTCTGATAGGGTGGGTGCCTGTGCTC
AGCTATATACACTTCCGGCGGTAATGCGCTGTTGCGCTCATGAGTAACTGCATCCCTCTCTCTCTCTCTCTCTCTCTACCGCCCGTCGTTCGTCAGACTA
AAGCGTCTAGAGTGTCGCTTCCAGCTGCATGATGTCGCTCTCAAGAGCGTTAGTGACGCTGGGGATGACGACGCGCAAAGAGACCCACCAGCTGGGAAGA
TACGAGAGAGAGAGTGAAGGACGTATGCATGCATGGATGCGCGCTTATGTAATGCTGTCCATTGACTGTTCCCTCTGGTTGGTTGTTTCCATCAGGTACC
TCCTCCTTCAAATATTTGTGTCAGGGGTAGCTGTTCGGTCACATTCACATAACAACCAGGTGGTGGGCGATCAAGAGAAGAGCTCTGCTGCAGCGTGCGG
CTTTCCTGTACGACGATGGCGCAAGAAGAAGCAGCAACACAGCAAGAGCAGCGCGGCGGCGCACGTTTGCACGCGTTTCTCCCGCGCCATATCATCGTGC
TCGTGCACGGTAACAATGGCGCACCGACGGATTTCGACGCCATCGAGAGCGCGCTCGTCAAGAAATACGGCTTCGACGACATCCTGATCATCAAATCCAA
GGTCAACCACACGCAGACGTCGCTGGGCGTCGAGGTCGGCGGTTCGCGGCTCGCCAGCGAGGTGTACCAGGAGGTATTCCAGCACGAGTTGCACCCGGAT
ATCAACTCGTATAAGTTCTCGATCATTGCGCACTCGCTCGGCGGGCTCTACGCGCGCTTTGCGCTCGTGCAGCTCATGGAATCGCTCAGTCCGCTGGACA
TCCAGTACGTCAGCTTCGTCACGATCTGCACCCCGCATCTCGGCTCTCGGCGGCCTCGAGGCGACTCAACGCTCAAAGTATAGTACTCTTTCTGTGCTTG
CAGTTCTTCAAGAAGGCTGTGTTGCTGATATAGTATTTTATGATGAAAATGACAGAATGTGTGGCGGATGGGCGTTCATACCGTGCTCGCGACGAATGCG
CTGTATGGGCGAACGGGGGTGGACCTCCTCATTGATAGCAGCAGTGATGATGACAACGGATCGCCGGTGCCTCCGATTCTGGAGACCATGACCAACCCAG
GTAGGATGCATGTACAAACGAGGAGGCTGTGGTTTTCACTGCTAAGACTGTGCTTATATGTGTGCCGTTGTGCAGAGTTTGAGTATTTGAACGCATTGAA
GCGATTCCGCTCTGGTACGCTGGTGGCCATGACGGATGGCGACATGCTCGTGCCGTACGCGTCTGCGTCGATCCGGAATTTCAATCCATATCCGAGTGCG
ATGTTAACCGACAAGTTCACGGAATGGCGATGGCATGTGCACCATTCTGGGTTCACGACGCCAGTCGAGACGGACAGTTGCCCGCCTCCTCCATTTTGGC
GAAAACTGGGCAGCAGAGTGAACCTCGCGACCATAACGATCGAGAAATTGCATGTTGGCGTCGACGTGAGTACGTGCGAACGGTTTCAAAGTGTCGAAGG
CTACGACGCAGACAACAAACAGGAAGTCGAGTTCCCATATGCGATGATCCAGAGGCTGCAGCAGGCGATCCCGTGGCGTCGTATCGATGTGACCGTCGAG
CCATGCGGCGTGAAAGGCAAGTTTCGCATCCATGACTGGCCGATCAACAAGATGCAACCTCCTGGCTGCCGCGCCGACGAATTCATCGACCTCTTGTGCG
AGATGGTTGGACATGATCACGAGCTGGAGCCGCTCCTAGAAGTCAATGAAGACCAGCGCTCGTCATCGAATGCGACTCCGGTGGACAGCTCCGACGATGA
TACTGCGTCACGGAATTCGTTTGGTGGTCCCATAATCAATCGCTTTTTGGAGAAATTCCAGAAAACGACACCGTCAGATAATCAAGTGTCGTCGCCTGTA
TCGGCTGAGAGCTCGAACGTCGATGACGAAAACCAGCAACAGCCTCGGAATTCGTTCTTTGGCAATGGGATGAACCGCATGCGCGAGAAGTTCCAAAAGA
AACAAGATGTAGGATCCCAATATGATGGCGCCCAGCCATCGCCATCGACCAGCAGCGGTGTGGCGGGCAAGTCAATGGAGACGGAGAGTGAAAATACCGG
CAGGAGTTCGTTCGGCGCCATGGGAATGCGGTTCATGGAGAAATTTGCGAAAAAGGAGACGCCTTCGCCAGCCCCGACGACAGCCGGCACCCCAACAGTG
TCTTCTTCCACGACCACTTCGACCGATTCGTTCACGACCACGTCGTCTTTTGTAGCGGGTCGCATGTAAAATTTCCATTGTGGCTATGCATAAACGTATT
CATTCAATAGACCTTCGTGTGAAAGTTGCTGCTTTGTACTCAGACTTCACTGGACTTGCATTTGTCATGCCGTATACGTGCGTATGGCTTGAATCCATTG
TTGGCACGCCTCATGCGGCAGATTGAGGCCAACCTGCAGACATTTACTCGTCGCGACTTCGCACGCCATGCGCAGAGCCACATCCAGTGGGAGCCCTCTG
GACAACGCCGCAATGCTCGCTCCGATAAACGAGTCGCCTGCACCAATCGACTCGACAACCTGGTCCAGTCGTTTCGTAGGGATCCGACGAACCATTTTGC
CCTGATCGCCACTTTCTTCGTCCAAGTAGTAGACGCCGTCGGCACCCCAGGGAGAAATCAGCGCTTTCAGCGACCCGGTTGCTTCGGTTTGCAGTTTCTT
GAACTCTGCCTCCAGGAAGCACGCTGCCGAGCCATATCCGAGCTTGTCGCGAATGTAATCCTTCGACACAAACGCAAAGTTCGCGCTCGCTACTAACCTG
TTGTCACCAGAAGTGACACACAAAAGCATTGTGGATACCAGTCGTTGGTGTAGATTTATCGGACGAAAGCAATATCAAAGCTCACTTTCGTGCGAGCGCC
CAATCGTAGCGCAGTGCTTCGATTTCCACCGAGACGACGGACTTTGGCGGTGCATTGGCGCGCACATACTGCATCATCTGGAGCACGGGCTCCATGTTGC
GACCTTCAAAGTGGAACCACATGGGGCTAGTAACACTAGTGGATGTGCACGACATCAGCGACGACTGCACGACTACGAATCGGTCAAATGCGCGCTGAAA
GTCTGCCACGCTGAGCTCTTCAAGGTCACGCGAGTGGACAATTGTCCGTGATCCCGTGGCCCTGCTCGACATAATGTACTTGAAGCAAATAGCGCCATCA
ACAACTCCACACTCGGCGGGCATCATGTTGATTGACTCAACTCACCGACATTGGCGTGGATCCGTTGGGCAGGATCGTGCACGTGGAGCAGTCGACGCCC
GATTTCGCGAGTTCCGAGTGCGCAAACGCCGCTTCGCTGTCTTTCGTCGGGTCGGAACTCGTCCCCATCCAATGGCAGGAGCTCCCCAACTGAGCTGCGA
CGACCTGCGTACACACAAGAGCACTCCATTACATCCATAGGCATGGCCTGGACGTGGGATACACTGAGTGTATTGCTACGGACCAACACATTCGCCCCAT
TACCGCCTCTGAAAGTGCCGAAGAAAGACATATTAGGGCACTCTTCCGCCAATGTGGAACTTGTGGCTAACAGCAGCACACACACACCTGCATTTCCGAC
GTACTAGCGATCGTATCTGTTTTTTTCACACCAGCAAGCAAATGTGAATATTGCGCATGCATTGAGATTCATGCAACAGCCAGCACTCTACCGCGAACCT
TTTCATCCTCTAGAGCACATTCACAAGTCCATGAGCACAAAGCATACGAATCAGCGACTGTCTTCCCCCCCTCTCTGCATACATGTAATGCCCAACACAC
GCACCTTTGGGGAACTCGGCGACCTCGTCGATGATGTCGACCGCGACGATCCCCACACCCACCACCTCCATCTCGCCTTGCTCTCTTCCACTAAATTTTG
CGTCAATTTTTTCTTCTTGTGCTGTTCATACGTTTCGTCCGTTGCTTCAACAGTCTCGACTAAGTGCGAAGGCTTCAACAGAATCAGAATTCCGCTGTCA
CACATAAATACGCACCGCACGCATTGAACACGATTATGATGCAGTTGAAGGTGGGTACAAAGTGTTCGCTCTCTCCGATACACTATCGATAATATGTCTG
CATAATTAGTCTGGAAAAAGCATAGCAGCACTTGATGCAACGACAAAGCAGGAATGCCGCAGCGAAAGAACCGCGAGTATCACTCGAATGGATGGACGGA
CATGCGTGTACAGGTAAGGTGCAGAGTGGAATCATGGATCCGCCCTTCGTCGCCGTCTGAGTTACTCGGCCGTCTGTTGGATCGAGAAAGATCGAAAGGC
ACAGGGGCCTGGAACGCTTATGCAGCGCAAGGATACGCTCGCTTTTGTCTCCCAGTATGCCGCCATCCACGTCATCAGGACCATTTTTTTGCCAGTTAGA
GGTAGACATGCCATACATACTACAGACACTCTGTCACACACTATGCGAGTGTCTTATTCGCAGTTCTGGAAAAGTCTAGAAATAGAATGCCCTATGCGGA
GCCAATCACTGTCCCCTCTGACCTTTCGCTAGCCAATGCACGTTCTCGAAAGATCCTTTTCGACCAATCAGGATCGAGGCAGATGCCCTTTCAACGTGTA
TACGTAAACTGACGGACTTTCGCACAAAAAGGCAACGTCAATGCCAATATGGCCAACGGAAGAATCCACCGACGCGCGTTACGAAGATGCCGGCATTCTG
CAATTCACTCAGCGCCACAACAAGCGAAAGAGAAAAACCAGCGACACAGCTAAAGAACAGCGACCGACAAGATGATGCCTGCGCGACCACCAGAGAACAA
CAGCAGCGATAACAGCAGCGATCCGTCCGCGACGACGGCGCGATCCTTGACGGCGTTTCTGATTCCGCCGCCGATGACCGTCGTGGTGCAGTTCAATGGC
GGCCTGCAACTTGAGTTCACGCCGTCCCCGGAACGCCTCGTGAGCCCGCTCATTGGAGTACCCATTGTGATGGGCGGCATCCCAATGACGTTTGTCGGCG
GCGCGCCGTCGGGTATGGAGAATGACTCGATGATGCGCGCGATGCACGAGCTGTTCATACGCAGCCAGAGCGAGCAGCGCGGTCCGCCGCCGACGAGCAA
GTCGTTCTTGGACACCCTACCGTCGAAGATTTGGGACAGTGACGCGAACAGATCGGAAAAGTACACGGATTGCGCGATTTGCTTGAGCGAGTACGAGACG
AAGGACCAGGTGATCTCGCTCCCATGCGGCCACGTGTTCCACAAGGACTGCGGCATGCATTGGCTGGTGGAGCACAATGTGTGCCCCACGTGCCGATACC
AACTGCCCACGCAAGAAGATGCGAACAAGCCAGCTGCGGAGAACAGCAGCGACAGCGCAAGCAACAATGCTGAGCCGGAGCCCGAAAGACGACCGGAACA
GAGCCAACCAGACGAAGAACCAGAGATCGAAGCGATCCTGCGTACGCTGCTGGGCGTCCGTCGCGAACGCTCCAACACCAACACCATGACTCAACCAGAG
CGCGTGGTGCGCCAGCGTGTGGACAACAGCGACTCAGTGCTTCCTGGCGCCGTTCCATCGTCTACATCAGAGGACAACAGCAACAATGATGCGGAGCTCG
ACAACATGCTGGAAGAAGAAGCGAGACGCTTCGTCGAAGAAGAAAAGTGCTCTATAGCTACGCAGCCACAGGCTGCTGATGACGGCGCGGCCATTTTTGA
CGACGTCGACATGGAAGAGCTCCTCCGTGACACGCGACCTGCGACCAGTTCAGCCTAAACGACGACCTTACGATCACGAGGATAGGAATTAGTATTTAGA
CGCGGCCAGATTTGAGTTCTGGGTCGCAGGTTCGGCAACTCATCACGATTCTGACACGCCGAGTGTAGGATAGCAAACCACACATTTTTTTTATGATAAT
TTAAAGTTGTATTGTTGATATTGACATACATACCGCGATCGTGCAACAACAAGCACACCGTTATGTTAGACAAGAAATATGCATACTGAAATGACATGAG
TCGAGATTATGAAATAAACCTCCCCTCACTTTTTTCCATCATCGTCATCGATATCGATATCATACCATCCGCCACATTCCGAAAAATAAAGTCGTTACCA
TCGTCGTCGAACCACCCTCCAACGTCTGGGTTATTCGAGTCATCGGTATTGTCATCGTACGAGTCGACACAACCCAAAAGATATCCCCGGCAAGCACGAG
TCTTTGAGCGATGATCATCGAATTCGAAGTCAACGTGCTCGCATCAGATCGTCGACAACCCTTTGATTTGTAGAGCTCTGAACGGGTCTAGGCCAGTATG
TAGCATCACGCAGTCACTACTCGTTGAGAATGCCACTGGCTTTGAATGTTTTGATTAGCAGTTGTTCTTTCAACCCTGCTTACGTGGTCGATATCTATCC
CATGATGTGATGGACAAGATTCCCATTTCACTTCATCGTAATTATACCACCCATCGT