Description :
From Genome Similarity Track
Location :
contig_60:62892- 66995
Transcript NameFunction/comments
g9053.t1PREDICTED: hypothetical protein

Sequence
4103 bases(100 bases per row)
TTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCTTGTCTCAATGGAGACCACGATGACCCGCAGGTCAGCCAGCCTCGGTGCCTCCAAGGCCTTG
GTGAGGACGTCTGCTGGCATCTTCTCGCTCTCGAGGTACTCGGCCTTGAGCACCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAATGTGC
TTCGCCTTGCTCGATGAGCCTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACGCGCAGCGACATCGGGCTGGCATGCGTGACGCCCAGCTCGC
CAAGCAACTCGCGCACGCCCAGCAACTCCGTAGCCATAACCGAGGCTGCAGTGTACTCGGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCTTGCA
GATCCACGACACGGGCATCCCGTCAACCGTGAGCATGCCGCCGGTCACGGACTTCCTGTCTGCCTTGTCGGCAGCGAAGTCCGCGTCGCTGTACGCGATG
ACCTTCAGCAGCTCCTCCAAAGCCCCTGGCCCTTCATGCTTAGCCGCAGGCTCTTGGTCCCGCCAGGTAGCGCGCGATGCGCTTGCCGAGCTTCCAGTCG
GACATCGTGGGACTGTGGGTGCGTCGCGACGCTTTGTGCACCGCGTACGCGATGTCAGGGCGCGTGCAACGCGCCACCCACATTAGACTCCCCACGAGCG
ACTGGAACTTGCGCACTGTCACCACGTCGTCTCCTCCAGACGTGGGCAGAAGTTCATCTGACGCCTCGTCGATCTCGTTCGACTCGGCGCCGATCGGGGT
GCGCACGCTGTGCACTGACGCCATCCCGTGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGGTCGAGGTCGTAGCCCTCGTCGTCGTTGTACGACACT
CTCATGCCGAGGAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCACCGAAGAACGCGTCGACGGCTTGCTGCTCCATTCCCGTGA
CCAGCAGGTCGTCGACGTACACGCCGACAACCACCAGGACGCCTTCTCGGCGCCTGTAGTACACGCACATGTCCGTCAGACTCTGGGCGAAGCCCAACTT
GATGAGAGTCTTGTGCAAGAGCTGGTTCCAGAGACGGCCGGCCTGCTTGAGGCCGTACAGGGCCTTCAACAACTCCAGCACCAACTCGGAGTCGTTCGCG
ACACCCAGACGCTTGCGCACGTCCTCCGGAATCACCATCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCGGCCTCCTTGTCGGCCTTGACGTACGCGTT
GGGCACGTCGCCGTGCTTCGCGGGGACACGCCACTTCCTGGCGAGCACGAAGATCAGCTTCACGCTGCTCATCTCGATCACAGCGGAGAACGTCACGCTG
TAGTCGACCCCGAACTCCTGCTCGTTGCCGCAGGCGACGAGTCGCGCTTTCAGTCGCTCGATGGCGCCCTCCGCATCCATCTTGGTCTTGTAGACCCACT
TCGTGTGGAGCGCGTGGGCGCCCTTGGGCTTGCGCACGACTCGCCAGACCCCGTTGTCCTCTAGAGCTCGCAGCTCCTCGGCCATCGCGGCAAGCCACTT
GTCCTTGAGCTTGCTGCGCATGGCCTCCTGGTACGACTTCGGGTCGTGCTCAGTGACGCTGTTCACGATGTCGCGCGCCGCCTCCTGCGACTGCGCGGTC
TCGTTCGTCACGCCGCCGGCGTTCTTAGCCACAGAGCGCGTCATGTGGCGCTCGCGCGCCCACGGCTTCTTCTTCTTGGACGCACGCTTCTTCTTGCTGC
GCGCGCTCGTGGCCTCGGCCACCGACGCTTGAGCCTCGCTCACCGGCGCCTCGGCGCCCTCGAGCGTCTCGTCGCCTTGCAGGTAGAGCCTCTGAACCTG
CAGGTTCTGCTCTTTATCGAGCGTCTCGATATTCTTGATGTGCTGCGTGATCACCACCACCCTGTCCTTGGGCAAGTACACTCGGTACCCTTGGTCTCTT
CGCCCACGCCCACGATCATGGCCGTCTGCGCGCGCTGCGCGAAGTTCTTCTTGCGCGGGTCGCGGTACACGCTGCACGGCGACCCGAACACCACGATCTC
GCCGAGCGGCGGAGACTTGCCCGTCAGCACCTTCAACGGCGACGCACGCCCTGGGTTGGAGTTGGTCGGGCGCGGTTCAGAATGTACGCGGCGTACTGAA
CCGCGTCACCCCAGAACCTCAGCGGAAGCCCGCACGCGAAGATCATGCACCGCGCCATGTTCATGATGGTGCGGTGCATGCGCTCGGCCTTGCCGTTGCT
AGATTGGTTCCGCGCCTCACTGCGCTGCCTGGCCACGCCCGTGCGCTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCGGTGCGCAGAACG
TGGATCTTGCAGTCAAACTCCTTCTCGAAGTAGACTAGGAAGTGCTCGAAGAGCTTCGCCGCCGCGTCCTTGGTGCGCGCCAGGAACACGCGGCAGTAGT
TGGACTTGAAGTCCACAAAGTTGATCATGTACCTGTTTCCCAGGCGGTCCTTGGGGGTCATCGGCCCCTTCAAGTCGGAACATATCACCCCACCCACCCT
GTCGATGGGTGAGTGGGCGCCGGTGTCCTTCTTGGACCGCCGGTTCTTCGTCTGCTTGCCCTCGGCACACGTGAGACAATTGACCCGCTTGTGGTCGGTC
AGGTAGATCCCGGAGCTCGGCTCCTTAGCCAGTCGCTCCACCGAGTCATAGTTCAGGTGCGCCAAGCGCTTGTGAAACTCCAGCAGCGTGCCCTTCTGCA
CATCGCCCGAAACTTCCACAGGCTCCGTGAGCTCCTGGCTCAGCGCGGCCATGATCACGTCCGAGGGCAACTCATGCCTCGGCCCCACAGCGGCGCGCAC
AACCAACACGTTGCGCCGCATCTCGACGTCGAACGCCACGCGTCCACCGTCCTTGGTCGCGACGACGCGTCGTCCGGCTTGCTGTCTCAGCTCGAAGCCA
CGCTTGTCAAGCTGCCCGTAGGAGATGAGATTGTGGACCACGTCCTTCGCGAAGTACACGTTGGTGAGCTCCACCATCTGCTCCTTGCCACACGCCGTGA
CACTCAGCAGCACCTTGCCGCGCTTGGTGATGCTCAGCGACTCGCCGTTGGGCTGCACACACTCGTCGCTGCAGTCATCGACCTCCTCGAGGAGCGACTC
GTCGTTCACGAGGTGGCGGCTGGATCCACTGTCCAGGATCCAGAGTCCATCGAACTCGCCGGACTTCTCGCCGACAGCCAGCGTGATGTCCGCGCGCTGC
TTGCGGTCCGGGCATGTTGCTCTCAGGTGGCCCACACGGCCGCACTCATGGCAGCTCCGTGTCTCCTTGCGCGAGTAGCTGCCCTCTCGCACTGCGTTGA
CCGTCTCACGGCCTAGCGACTTCTGCTTGGTCGACTCGGTCTCCCAAGACTGCGCGAAGTGCGCGAGCTCCTCGGCGTGCTGCAGGTAGTCGGTCCGCGA
CTGATCCACCTTGGCCATCAACACCGTGCGCAGCTGCGGGGAGGCGTACTGAACAATGTTGTTCAGCACCAAGTAGTCCGCGCTGCTCCCCGTGGCCTCG
GAGATGGCCACGAGGTACATGTAGTGCTCGGGCCACGACCTCTTGGCGTCCTTCGGCGCGTGAACAGCTTTATGGCTTGGGCGGGCGTGATGTTGGTCTT
GAACGCGTCCAGCATCCGCTCCATGACGTACTGCAAGGTGGGCAACTGGTTCCACCAGGTGTCCACCTGCTTGTTGTAGTACCGCTCGGCCGTACCCGAC
AGGTAGTGGCCGAGCAGGTCTACCTTCACGTCCTCGGACCATGGGAAGCCGCACGCCGACTGCCCGAGCGCCACCTGCCGCTCGAACCTCCTGCCCCAGT
CCAGGAAGCCGGAGCCCAGCCCGACGTACAGCTCCTTGCCGTCGAACGGGCGGATCGCCAGCTTCTTCTGGCGAGCGTCCGGGTATCGGAGCGCCCGCCC
TGGTTCTGCTGCAGATACTGGTACTGCGTGGGGACGGCTGGCGGCTGAGCTTCAGACTGCCGAGGTGCTGGCGTCGGTGCCGCCGGTGGCGGCTGCGCTC
TTT