Description :
From Genome Similarity Track
Location :
Scaffold_139:62875- 64996
Transcript NameFunction/comments
Physo_143444hypothetical protein
Physo_143445hypothetical protein

Sequence
2121 bases(100 bases per row)
ACCACTCACAAACGTTTTTCGCCTTGTGCTTCATCACCGTCGAAGTCTCCAGCACGGCAAAAGACGAGGTGACGTTGTCCATGCCGAACGCCGCAAAGTC
GGGAACGTTTCCGACGCTCGTGTTCACCACAGCCGCTTTGCCCGTGCAGTTGCCGCCCGTGTAGAAGGCGATCCTCGCCTGTCCATCAGCGTAAGCCGTC
CCCGTGACTGGCATCCCCGTCCATCTGGCTGACGAAATGCTGTCGCTGATCTGGCAGGGCATGTCGTAGCAGAGATTCCCTGCAGACACGATGATAATTT
GGCGCAGTCTCTTGAACTCAGGCTCCTTGTAGATCCGCAGCTCCGCACTCATCGCAGCCGCATGTTGAACGCTGCACGCCATTAAGAAGGCGACGAAGAG
TGCGAGCGTTGAGAAGACACGAGCGCTCATTGCTGAAAGGAAAGCGCGGCCTGGTAGTTTGAAGAGTGAGGATGCCGTGTAGGATATCTCCCCGCTTGAA
AATATTCACTTAGTCGTAGACGTCCACTAAAACTCCAGTAGATCGGGATGGCATTCCTCTGGTTTATCTTCGACCTCGGATGATGCTAATATTTTCGAGC
TCGTCGCTAACTTTCCAAGTAACTCAATCGATTCATATTATTTTATCGTCACGTCCCCAGTATTGTTACATTTTTGCGGGTTCGTTCATCAGTCAGCACG
TCACGAATTCGCTGCCAAAGTATAAATTCCTCAGTCCTCGCAAAACCCCCCACAGTCGAGAAAACACGAACATGAATGTAGATCCAAACTCGCCGTCGTG
AGATAAGTCCTGGTCTTTGCCCAGTTCTCGAATGCACTGCTGGTAGTGCTCCACATTGGCCCCTCCCGGGTGTTCCGACGGCGCGTACGACAGTCCCCCG
TGCGAGAACGACTCTGTCAGTGACTCAATGTTCCAGCAGCTGTCCGATACAAGTCGTCTTCTAACTCCATTCCGACTCAACAGGTGCGACAGATAGTAGT
CATCCCCCAGGAAGCAGGCCTTGGACATGTTGGCCACCTCGAAGGCCGACATCGTCGCCTCCTCCAGGCCGAAGAACTTGCGCTTCACTGCGACTCCACC
CGCCCCTCCCACGAACGACACGCTGTTGACCCCGACCGCGAGGCTGCGTCCACAGTACAGATCGTCCTCGGCCGAGATCCAGCCGCCCAGCACCGCGATG
GCGTCGTCCGGGTACTTGTGCGTGTAGTGCAGCGCGCGCTCGCACAGCTGCGTGGGGTAGATGCGGTCGTCGTCGCCGTACACGATGACGGTGTCCGGGT
CCTGCTCCACCAGCAGCGTGCCCAGCACCTTGCTGGCCGGGCCGAAGTCCGTGTCCAGCACGATGAGCCGGAGCTTGTCGTGGTACGGACTCGCCCCCGT
GGCGAACGTGATGCCGCGGAACTCGCTCTGGTTGAGCTTGGTGCGGCCGTCCAGCAGCCACTCGGGGATCTGCACGGCCTGGTCGCGGTACGTTTTGGGC
ACGATGACGTACACGGCGTCGAAGCCGTCGCCCTCCTGGCGCACGAGCGCGTCCACCGTGGGCTGCATGTCGTCGATGCCTCTGGGCGTCGTCGTGAAGC
TGAAGACGATGCGGGGCCGCGCCTGTGCCGCGCTCATGGACGTGGACGCGAGGGCCGTGGACGAGTTGAAGGTGCAGAGGAAGACGGTGACCCACGCCAC
GCTCGTGGCCAGGAAGCACGCGAACCAGCGCTTCCGAGACGAGAGCTCGTCGCCGTCGTCCGACACGAGCGACGACTCGAGCACGACCTTCTCCGGCAGC
AGCTTGGCCGACTGCCGGACGCGTTGCAGCCGTCGCCGCCGACGGTGCCGGACGAGCAGCACCGACAGCGCCGACAAGCCGGCCAGCAGCGACAGGAGCG
AGATCCGCGGGATCATGACCCGCTCGGCATACAGGTCGATGCACGAGTCGCCCAGCGAGTGGCCGCTGCTGCCGAGCGAGGTGCGCAGCGACGACGAGGC
CATTGAGGTCTGCAGTGTATGCATTTGCTTGGAGCTTGGCCTTGGAATTCTGCGAATGCCGGACGGAAGGCGACGGCGAGGTGAAGCTGGTGTTGGAACG
GCAGTAGGCTGTCGCACGCCC