Description :
From Genome Similarity Track
Location :
Scaffold_4:628669- 629713
Transcript NameFunction/comments
g3684.t1ETO82680.1 TKL protein kinase [Phytophthora parasitica P1976

Sequence
1044 bases(100 bases per row)
CCTCCCGAAGAACGCGAGTTCGCAGTCGTTCTAGTCAGATCCCGATACTCTGTTCCTGCTGGTGAGCGACCCTGCCACACATTCTTCCCAACGACTGGCG
ACTCTAAAACGTCTTCCAAAGACGCATCGCTTGGCCGGTGTTTGGTGCGCTGTCGCTTTGCGAAGAAGAATGCAAACAGCACGAGCATCAAGACGACGGC
CCCTATGATGATCCCGATAATTGCTCCGATTCCAAGGGACCTGGACGACTTGGAATAAGTGTTGGCGTCGGACAAAGAGCTGTCCGATTGATCCGTAGTG
CCTTGGTTGCTGACTACAGGACTCAAAACGATGGTTTTCTCTGTGTCCCCAGTCTTGGTGATGACCACGTAACTATAGGATGTGGTGCCGTTCCCCAGCG
ATGTTTCTGTGACTTTCACAGCAACTAGCTCCGAGCCGTTGAGCAGATTCGTATCCACTCCCGGGGGCAACGTGGATGAATTATAATGCTCCACCACAGG
AGCACTGGTGGTTGGAGCCTTTGTTGTAGGAGTTGGAGTAGCGGGTGTTTTTGCAATAGGCGCTGCCGTAGTAATTGGCGGGGATGTCGCGGCTGGAGAT
GGAGATGTCGTCCCAGGAGGGTCTGTTGCTGGTGATTCTGCATCCGGGGCTTCTGTCACCGTGGGATTTGTTGCTGGGGGGTTTGTTGTTGGTGGCTTCG
TTACCGGAGGCTTCGTTGCTGGAGAAGTAGTTGTCGGAGAATCCGTTGCTGGAGAGGTAGTTGCGGGAGGATCAGTTGCTGGAGAAGTAGTTGTCGGAGA
ATCCGTTGCTGAAGGGGTAGTTGCGGGAGGATCAGTTGCTGGAGAAGTAGTTGTCGGAGAATCCGTTGCTGGAGGGGTAGTTGCGGGAGGATCAGTTGCT
GCAGAAGTAGTTATCGGAGAATCCGTTGCTGGAGAGGTAGTTGCGGGAGGGTCAGTTGCTGGGGGATTCGTCACGGGAAGTTCTGTCTCGGGAGGGTCAG
TCTCGGGAGGATCCGTCACAGGAGGTTCTGTCTCCAGAGGGGCG