Description :
From Genome Similarity Track
Location :
contig_93:62864- 63873
Transcript NameFunction/comments
g10773.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
AGTGGAAAGTGGGCAGCTCGAAATTCTAGTGTCAATGGGCGAAGCACCACCGATCCGCTACGGACCTGGGTCCTGGCTTGGGTTTTGGCGAACTGGCATT
GCTCTACAACATGCACGCGCTGCCACAATCCGTGCAGTGACTGAAGTCGAGCTCTGGGCTCTGGAGCGTAACACTTTCAGGGAGATCCTAGCTTCGCACA
AGCTTAATCGTCTTCACCGGACACTTGAGGTTTTGGAGAAGGTTGCGATACTCAGCAAACTTACCTCATCCGAAAAGCAGCAGGTTGCAGGCAATGGACT
GGGAGGAGTTTGAAGGGAAAGCTGCAATTGTGCGCAGGGAGAGGTTGGTGAGAAGTTTTACATCATCACCAAGGGCGAGATTGTCGTCACTCAACTGGAC
GCCAACACGAGCGAGGAAAACATTATCCGAAGACTGAAGGCTGGCGATCATTTTGGTGAGATGGCTCTTTTTAAGGATGAGATGAGGTCTGCAACCTGCA
CGGCAGTCACAAGAGTGCAGTGTGTCACTCTTGTACGTGAGCACTTCATTGCAATGCTCGGCACACTCCAGGAGCTTATGGACCGAGAACCAGCCCAACT
AGAGGCGAAACACCTCGCGCACCGGCGAGCATCAGCCGAGGAACTAGTGGACCCCGCGGACTACAAGTACTACATGGAAATCCCTCGCGAAGAGCTTGAA
GTTCTTCAGACATTGGGCCGCGGTGCTTTTGGGCGTGTCCGCCTAGTGCGTCATGCTGCTTCAAACCGCGCATACGCACTAAAATGCCTGATCAAGTCGC
ATATTGTGGAGAACAACCTGAAGGAGCACGTGTTGAACGAAAACGAGTTATGCTTGCTCTAGACCACCCGTTCATTCTCAAGCTTTACACAACCTTCAAA
GATCGAACGCACTTATACTTCCTGGTAGAGCTTGCACTGGGAGGCGAGCTGTTCACGTATTTGCGTCGAAGAGACCATTTCGAGGAACCCATTGCACGAT
TCTACATTG