Description :
From Genome Similarity Track
Location :
contig_8:628336- 640934
Transcript NameFunction/comments
g1917.t1hypothetical protein
g1918.t1hypothetical protein
g1919.t1hypothetical protein

Sequence
12598 bases(100 bases per row)
ACAACGTCGAGGCGCTGCTGGCCAGACACAACAAGAAGTTCAAGGCCATGCACACGTACGAGCCCCCGCGGCACTCGGTCCGGGAAGTGAAGCAGGTGAG
ATATGAGTTTTTAGTACTTGTTGGAGACTTTTTACTGACATTATTTTTTAGTGGGAACGCGAGATGAAAAGGTCTTATTATGCTTTGTCAGCCGAGGAGA
GGGTGCAGGCAAACCAGGAGATTGCAGTCTGGAAGAAGCGACGAGTGGGGACGACCCACTAGAGAAGTTGGAGACGACAATTGTAAAGTTAGTTGATTTT
TATCTCGTCTCACATTGTTGTTGACTAGGTGTCTAGCATACAGAGCATTGCACAGCCACGGCGGATCCAGTGGTCGGGGCTTTTGTCTGTGGGAACGTCA
AGAGCGACGACAAAGTTGGTGGAGTGGCCTGTGGTGGAGAGTGTGCCGGCGCGGATGGAGGTCTTGTACAGCGGGCACTCGTACACGTCCGATGGCTTGT
ACTCTTCTCGTCGCATGGGCTTGAGCCAGATAACAGGCATGCGATCGAAGAGTTCGTTCGGAATGGACTCGGCCATCATTCTCGTGTTGCGGTCATAGCG
CGCACCTTCCATGAAGAGCCCGAAGATGTACACGCCGAAAGGCGGCGCAGCTTTGTACTTCTCTTTGTCCTGTGCCATGATCTCGCACGAGACAACGAGC
GCGTCAATGGCGATTTTCTTGTCTCGAGAGAATGACTGCTTGACGGCTGTCATGAAGCCCTGTGGAAAGAAAAAGCCTGACAGCCAGAAACTCAACGGCG
GTCCTTGTACGAGCCAGTCGTTGGTCAACGTGATTCGTATGACGAAGTCTTCTATCCAAGAGGCCAACGGCTTCAGGCACGGATATCCAGCATTCTCCCA
CTCGCTTGGAATTTGCTGGATCAAAAACCCGTTGTACATTTTCTCGAGCGGACCAGACATGACCACCAGCCCCTTGATCGCACGCTTGAGCATCTCAAGT
GTCGTTTTCATGACTTGAATCAGCACATTGAAGCGGATCATCTCCTGCGACAGGAACACGCCCAGTGAGTTACGACTACCGCCTGCTGCTTCTTGGAAGG
TCGATGGGTGCGCCTTGCTCTCCATGAACGCATCGGGCATGCGTTCTTGGATCGCTAGCACCATCTCCATAACAATGCTGTCATTACTCTGCGCGGCACC
GCCGCCGCCGCTATCGCCACCTCCACCCAGCATCTTCAATATCGTGCCCAGCAGCTGACCAGTTTCCTTTTGCTGGAATGTGATGTCTGCGTTGGCGTGA
AGACCGAAGATGTCAGGGGCATCTGCTGTAGGCAGTGAGCTCACGTACTCGCGGACAGTAACCAGAGAGCCTTCGACTGGCGCATAGTAGAGTCCCGAGG
TGGTGAACTTGTACGAGTCGTCCATGACTCCTTTGCAGAAGAGCTTGCGCATGATACTCGAGTTCGTTCGCTTGTCCCAGCGGTCCGTTATGCGACCACC
GTAGGAAATGTCCGCTACCATGACGTTCAGCGTCAGGTACGGCACCTCTTCCTGTTCCTCCAGATACAGCCGCACCTGCTGCATTCCTGTCTTTAAGTCG
CTGTTCATCCACTCGTACGGGATGTTCCAGCCAACAGCACCAAACTTGCGTCGCTCAAGACACACAGCGTTGTAGAAGGCTAGCGCGAATAGCAGCTTCT
TGAACTCACGCGGCTTCGTGCAGCCTTCGAAATCGGCCTCTTTCATGTCAAGGAACGTACGTCCTAGGTTTGCCTTGATACCCTTCGGAGGCTCATTCGT
GATCTTGATTCCATTCTGCAGGATAGGCACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGAT
TGCTCCAAGATCTGCTCAAGCCGTCCTAGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAG
CTTCAGCAATCGGGCCTTGGCCTTGCCCAAGCGAAATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGAT
ATCGGCGCCCGGTGAAAGTACGAAGATCAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCACCAAGGTCGAACGGTGGAGACTCGGTGAAGAATTTA
CCCAGCTCACGCCCGACGAACTCGCGCGTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATT
CCCAGGGTTCCGGTAGTGCTTCGGCATGCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGT
AAATGCCGGAGAAGTATCCTTCATACCAACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCT
TGAACGGCTGAACTTCTCTTATCGCCCACCAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACG
CGTAAATTATCTTGTCTTTCTCGAACAGCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAACCGTTCTTCCAGCAC
TTCGGACTTGGTCGAGTTTTGAAGCCGCATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATT
GCGAAGTAGATAATCGATCCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATACGAGTCT
TAATCGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTCCCTTGGAGTTCTCAAGCATGTACAGAATCTTG
TCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACGTCCA
CCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCTTTGT
GGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAGCACG
GGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTTTGCG
ATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTGTACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGCGCCC
CATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCGCTGG
AAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCAAGGT
ACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCTCGCC
CAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAGTGTT
CGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCCTTAA
GGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATACTGCT
CAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTTGTCC
AGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTTCATTGTGACACCCACAAGTCTCG
GGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATATGCGGGCATAGCTTCATCCAAGTC
CTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGTTGCTGTTTGTCAGCTTCTGCC
TGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTGAGCTCTTCAAGTTGCCTACGA
CTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACGCAGCATATCCACGTACAGTCG
AATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCAACACTGCGGTGAATTGTCACG
GCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGAGTTAAGAGCGTCTTCTGGCC
ATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATAGGAGAAAATGCCAATACCAC
ATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATGGACGAACGAGACCCACAATT
TTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTCATGAACGATTTGAGCATCCG
AAAACAGGAAAACGACAGGCTGGTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGCCATATCCACGAGTAATTTCG
ATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAGTAGAGCATTACCGCGAGGCT
GTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTGATGTTGTACTCTTCGAGATA
CTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCATACAAAATATTCTCGAAGCGC
GGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTACCAGACGATCACGGAAAACT
CGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTGGAATACTTTGGAAAGATCAC
GAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCTCACAATAGGTGCTGCCAT
GTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGATTGGGATCCAAACCATGT
GGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTTCACATTTTTAAAGAACAT
TTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGCGCCGGCATATTCAAATCA
TCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCTCGTTTAGGTTGCGAGGCT
TGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAGATTTGCCAACACCAGT
CTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCACCACCATCGTGAAATAC
GACGCTCCGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGTACACATTAGTCACGGG
TGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATGTTTGCTCCGACAGAC
CACGTAACAGCGAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACAGGATGCCAGGAGAT
TGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACATGAGTCTCAATCAA
CAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCCAAGGATGTCAATCCTACGTGCACT
TGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGGGGCAGTTTGA
TTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAAAATGACCCA
GTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTGAACTCACCA
TACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGTAGAGTTGAG
TCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTCGTGAACCTG
AATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGTAGCCCATAGTCGACAAAAGGCACC
ACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTACTGTCTCGCATAGCTCGGATGAGAA
GCAGATCCTCGTGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTGATCTTGCTT
TGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCCGAGAAAAGCACGATCTCGGCAATT
AAACGGTAGTCCGGCACCATCATAGCAACGGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCATTGTAATG
AAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTACCTGCTGAG
CAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCCATAATCTT
GTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCTGTTTTGCCTGTACCGGCTGGTCCA
GCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGGTGAATTGCCAAGAT
ATTCATATCCGTAGATGAAGCGCGTGTTGGTTTGTCTAGCCACAAAGTTCTTCACGTCATCCTCCCAATAGTACCGCAGCTGTCGAGTCCACTCAAAGTC
ACTCAGCGAAGATACGTTACTATCAGACAATGAGCGTACTACATCTCGAGCGTGCACATCAATAGTGATGACAGCACCCATGAGAATGCGTTGCAGTTTC
GTCAGTGGCCCACGCACAAGCTGCACCATACCATCAATCTGCTTCAAGCTGAATTGTAGGAACTCGCCAACAGCTTGCGGATCGCTGCCGCTCTCAACTT
GTGCGATGGCTTCCGTGACATTTCGCGTCCAAAAGACCTGATCAACGAGAATGATCATCTGCGCTGAATATCCGAATAGCCAATCTTTGCGATCAATAGC
ATCTTCGATGGGGTAGTTCATAAGCGCCTTGACACCGTCCTCATACAGACTTGCGCGCATCGCTTTCTCCACCTCAGTAAGCCAAGCTTCCACGGACCCT
TTGCTATAACCTGATTAGGGAACACAACGAGCTCACCTTCACCGCTCACCATGGCGTTTACAACGTTACTAGCTGAACCGGGCGTATCATCGAAGCGCAC
ACTCTTCATAGCGTCGAAACATTTGCCTAAGTGCGGCTGAACTGCGCGTGGATCACGGGTCTGTGACAGGATTTCCAGCAGCTCGTCATTTGATAGGAAG
TAAAATCGTGGGAATGCCATGCGTTTGGTTTCGAGATAGTCCTCTAGGGACTTTTGAATCTCTTCAAGCAACTTGTTCGACATACGGAACTGATCCAAGA
GCTCAGATCCACCTTCCACCGATCTAATCACACTGGGGTCGTTCTTTGTTCGTAGCATAGTCGACTTCCAGTTTTTGTCAACGAGTGCGAACTTTTGGGC
CTCCACAGGAAGTTGCTTTTGAATGTCTTCGGCGCAGAAAATGGTCTCCAAATACATCCAACTGCGCTGGCAAGCGATCCACTCATCCAGTGTGTCCGAT
AGGAGCGACAGCCGCTTGCCCCAGCGCTCCACTTCATCTTTCACGCCCATGATAAACCGTGACCCCATCATTGTTTGAAGACCCACTTGATTATCTTCAA
GCAGCATTAGAATATCTTCAAGACTTCCAAGGATGAACACGTCGTTTTGGTCGCGGTGGCTTACGCAAGTGAACTCCATTTGCTCCCACCCATGCTTAAT
CTTGAGCAGTGATGCCTCAATCTGGGCCTCGCCGGAAGCTGCTGCCGACATTTCACCAACAAGGTCTTTCATGTCTAGCACGTCATACGCTACGAGGTTT
TCGAGTGTAAACAAAATACCAGGATACCAAGGCTGCCGCAGTGCCTTGAAGATTTTCTCCCAGTGACGATCTTTCATTGCTGGGTTGCCCAGTTCAAGAA
CGGTAGGCATCTTCAGCTTGAATTCAGCCGTGCGGTCCTTGAGCACGGCAGTAACATCGTTGCTCAATTTCTTGTGCAATGCGTAGGCATCCTTAAATGC
TACAGCGACATCCTTTGAAGCTCCTCCGCATTCACTTCTACGAACGGGCTAGTCATGGCACCCAAGTACAGCTCGTTCCACTTTTCAACTGCCGTCCAAA
GTGAGTCGACTGTGGCAAAGTACTCTTGTGTTGCCTGCAGGTTCAGGTACTTAAATGGCGTAAGATTAAACAGCGACTGATACTCTGTATACTGCTTCGA
GAGTTCATCCAGCTGAGTGAGCCGCTGCTTCACACTTTCCAGTTCATTCTTAACCACTGATGGATCCTCGAAGTGAGTTGCATCAATGAAAAGTCCACCT
TGCAGCTGGTTGTGCAACTGAAGTACTTGCTCGTCGAGGCGCTGAATATTAGCGTCCAACTGCTGAGTCATCTCACCCAAACGACTCGTTACGAAAGCCT
CAACAGCCTCAGTCTCTTCCTTATAGCTCTCTTGTACACCACGTAGGTCATCTAACTGCACCATGTCTTCTGATGAGATGCGTACGCCGTAGGTACCCAG
AAGACGGTACAGCTCGTCTACCACATTCGTGTTTTTTGCGAGCGCTTTCTGCTTTGACTTCAAAGTTTGCACACGCTCCACATGCCCGGCAAACTCTTTC
AAGTGTTGTGGACGCTGTAGCAGGGACTGAATGCGCTGCTTGTACTCACCCAGCTGAGTTTTACATCGTGCACGCGCCAAGTCTTTCACTAAACCCTTCA
TAGCATCCAACTTAGCTGTCGTCATGGGGATTAATGTCTGTTTCAGTTTCCTGCTCTCCACGTGTAGAATGCCGATAGTCTGACCAGCTCGCATTTTTTC
GAGCTCCTTCTCCCACGTGCTAATTTGTAGCATGTCTGCCTTGAGCGTGGTGACCGTGTGGGCACGTTGTGAATACTCCTCCAGGTCCCAAACCTTGTCG
TACTCGTAGATAGGCCGCACGTTGTCAAAGATTTTCACATATTCAGTGCCTCGGCATAATCGCTTGCGATCTTGGCAACAAGTTCCTTACGGATCTGCCC
GAACGCGACGCTGCTCGTAATGGTAGAGCCCACGTGCGGCGCGTCCGCAACAACGTTTCCCACATAGGCAGCAAATGGTCGGAGGTATAGCACACGCGAG
ACTGAATTCACGGTGCTCACGATATCATCCGTCATAGCTATTACTATGTGCTGATTTGTTCACTTGTTGGGGCAAAAATGGTGGACTGCTCTCCGAAAAA
TAATGTCGTCTCAAAGAGTCCTGTCTTACGGGGAACTTTGTTCAGCTCGCAAAGAAAGTTGGCGCAGCTCTGCACAGCCAGAATCACAAGACTCTCAACA
GCGATGCAGTCAATAAGACGGATGAAGTCCGCAATCATGCCTGCCTCCTCAGCGGCTCGGCGAAAGAGTCTCCGTCGTCGTTGTTGCTCCGCCTTGACAG
CTACAATCGACTTGGTCTTTTCCTGACTGGTTCCCATTGCCCCCAGTGACATATCGGACATAAAATCCTCTTGTGGGTTTGACGATTTCGTCAAATTTTT
CACATCGGAGCAGACACGCTGAATGATCGACTGCAATTTCTCAATGCATACCTCAAACTGCTTCGAGCCTTCAGCACGTTTAGTGCCCTGGTACTCCACA
AAAGCCGAGCTTTCGTACGTCTTTTGAGCGCGCAGATCCAGCAAAACAACACCCATCAGCTCAGTGCTCATCACCTTCTTTACCTGTAGCAAAGGAACAC
AAAAGCTTTCCTTCGCCAAAAACAATTTCGTACTCAGCCGCTTGCGTTGGCGGCAGTAAAGCTTATAGCGCACGTTGGCACACCAAAGTGAAAACGCCTT
GTTTACGAGGTAGTGCTTAAAGAAGCGTAACGACGTAAGCACGTTGAACATCGTAGACTGACGCATCCACTCCGCCAACGCAATGAACTCGGAGGGACTG
CCAGTGCTAACGTGCACAAGTCCGCTAGACGACATCGTAAAGTGCTCATTCGGAGTCACGTCGTCCTGTGCAACGACCACAAGATCATACGGTCGGAACG
TTAACCCAGTTTCCGCGCGATTCAATGCACAAACTTGATCTCGCTATCCGATCCATTGCGCGCAAAGAAGGCGATAGTATCCTCGCCTGTCTTAAGAAAA
GCTGTCGCTGATGCTGCCGCCGCTTCAGCAGCTGCGTCTGCTACGATCACGCTAGACGTCCCAGTTACCGGATCATGATGGCCTATGAACTCTGACGGAC
GCCGATCCCGCTGGTTGATAGCAGCCTTTTCTTCATCTTCTTCGCCTCCTTGCTCGCCATACGACCGAGCAAGTGTAGTGCGGAGGAAACGCCGTGGCGA
AGCCTCCCGCTTCGGTCGTCCAACCTCGCCTTCCCACGAAACTCCAGTTGGCGCAGGAAACGCATCGCTCGCTGCTTTAGCCCCAGGTGAAGCCACTTGC
GCCTCTTTTGCTGCGTGTCCAGGTGGAGGTTTGGCTCGATGCGGCTTGTGCTTGCGTTCCGGGCTATGCAGCGTCCCCGGAAACACTAGGATCTTCTTTG
GCGACGTGTATTCCTCTGCAGTAGTGAACGTGAACTTCTGGCTCGCAGCCGAATCCACTCCCACCGTCATGGGCGACTTCATTGCTGCCCGTGCTCCAGG
CACCGCCTTCATGGGTGTGTTGGACGGTAACGTGGCTCCGAATCCCGACCCACCATCAAACTCGAACGTCGCGTCCAGCGTCAGGTCATAAATCGAGT