Description :
From Genome Similarity Track
Location :
contig_104:62828- 65757
Transcript NameFunction/comments
g11073.t1hypothetical protein

Sequence
2929 bases(100 bases per row)
TACACCTGTAACACCGACACCGTCGAGCGGAAACAGCGGCGAAGCCCGACCTGTAATTTGTGACTTTGATGATCGGTGGAACTCAACGACGGAGATGATG
TGCCGCATCGTGGAGTTGGAGCCTATGTTACTGCGCTACAAAACTGGACTGGAGAGCGACACGAATCCTGCTCGAAGACCGATGCAGCTACGCTTTGTGT
GTTGTGAGCTTTCCCCGGAAGAGTGGGCAGCGCTGAAGCAGTTGGCACGACTTCTGGATCCTATTGAGGGATTAGTGCACGTCTCGCCGCTCGCTTATCC
TGGCCTGTCGATCGTGTATCCGCTCTTGCACTCTTTGAAAAAGCATTTAGCGGATGCGGGGGCGTGGGTGACTGATCCGCTTGTCGCGACAGTTCGTCAT
ACTATCGTCGGCAACCTTAACATGGACCTCTGCTCATCAGGACAAGCTCCATCGTCGCCGTATTTATCGTGTCTACTAGACCCACGCTTCAAGTCACTGC
CGTTTTTGCCAGCACCAGAGAAGGAACGACTCATCGAGGCACTTTACTTGCTTCTCGGCGTGAATGACAAGGACGATGAAGGCGTCGATGATGGTCAGCA
CCAGCACGACTCATCTACTGAAGACGATCAAAGCGACGAGCAGAAAAACAAGACGGAACGCCAAAGGTTCGACTGCATCGGCAACAAGCGCCTCTCTTGC
CAACAAGAAGGCAGCAGCTCTGTTGCACGAGTTCTTCCCGCTCGACGAGCCTGCCACCGAGCTCGACAAGTTAAAGGCTCAGGTGCAGCAATTTCTGGAC
TCGCCGTCTCTGCCGGCTACAGATGAGACCGAGCACGACCCGCTGGAGTGGTGGAGTCGCTATCAGCGACTTTTCCCGTCGCTAGCGCGACTCGCCAAGA
AGTATCTGTGCATTAGTGCCGTGTCAACGCCGTTCCAAGAAGCGTTTACAAACTATGGCCAACTGATGCGAGAGAAGAAGGCTCGACTGGACATTGAAGT
GGCAGCTCAGGTGCTTTTCTGTCGAAGTGTTTCTCGGATCCCAGAGATGGAGCGCATCGGAGTTTGAGAACGGAGGACGATGAAGAAGATGTTGTCGAAG
GTGATTATCGTGTTTATTCGTGTGGCCTTTCAAATTATTCGCTTTACTCCCATGGATCAGCTTGTTCGAGGTTTGGCATGAGGTTAGCGTCGTTCATTGG
CGCCTCGTTGGCGTTGAAGTCCACAGTTTCCAGCCCCGAGCGTACGCCGTCCGTCAGATCGTCCCACATGACTAATTGATGTTCTTCAGGTAGTGGCTAG
AGCCAAACTTCACAGTGTATTCAAGCTTGAAGCGAGTCCCGTTCAGCACTTGAGGAGCAGGAGGTACGCACGTCCGGTACCGATTGGATGCCTCCGTTAT
CGCCACGCCCATTACTGTCGAGCTCGTGGAGGGGTTGCCCAGCCATACAATAGCATGCTCCCAGCCACGGCGATGGCCAAAGTAAGACGGGATCTTCGTC
CGGTCTCTCGGAAAGTATTACGCGTACATGACGGCCCATTTGTCGCTCAGCTCCGTCGAGCGGCCGTAAACCTGGGGCCCGAGAGGAGAGCTCGAACACT
CGTAGGATGTACCCACCGTAACCGCGCTCAGCCCTTCATTGGTGTTGGCATCTTTATCGACGGCAGGGAACGGCATACAGCCGTCCGTAATGGACAGGTC
TCCTGGTCTGGGGCTCACTTGTTAATCCTCTCCGCCAGTCACAAGCTCACCTCTACCTTTCAAGCGCCAGCAATGAACATCGGGCGATTCTTTATCGTTG
TGACTGTCGCGCTCTTCTCCATCAAGGCCGACTCCATTGACCACGATAAAGTACAACCGTTTCCTCAGCCGCAACCTGTTACCATCTCCGAAAAAGCTGG
TGTCAAATTCAAGCCGAAACTCTTTATCCAAGAAGGGTGCGTCTCGTACCCCGCCGTGAACGCTGCCGGCGAGCCCAGCGGAGGGCTGAAAGGAACCGGG
GATGATTCCGGCTGTAAGCTTCCTTCATTGGGCTCACAGGTCTACGGCCGTGCCGAATGGTACAACGACGTCTGGGCCATCATGTACGCCTGGTACTTCC
CCAAGGGATTCTGGGATAAATGTCCCTATTGGCGTCATGACTGGTCAAATGTTGTTGTGTGGATCGACAACCCGGACGTTGAGACCTCCAAAGTGTTGGG
GCTATCCCTATCGACGTCCGAGAACAAGTATGGCCACAAATATGCACCTGCAGAGTCCATTAGAAATGGCACAACGCCGATGCTGTATCGCTATCTTCCA
TCCTTCGGCAGCGCTGGGCTAAACACCTATGTCGATTTGGGCCAGTTCCAGGATTTGATCATGTGGGATCAGCTCACGGACGCAGCTCGTGCCGCCCTCA
ACGACCAGGACAATTTTGGCCGCACCGAAGTACCGATAAGCGACGATCACTTCCCCGAGCATCTCGAAAAAGCGTGGCCGTTTTAGTTGCCATGGCGAGA
CGAAGCTTCTGATGGGAGCGTGATGGCATGGCTCGCGCGGGGTTGTCCCGTACGCGCTATTCCGATGCTGACATTCGCCATAACTTTCCCCTATGCAAGA
AGTTCTTCCGTTTTTCAGTGAGGTACATTGATGTCACTTAGTTGTGCTAACGACTTCCTATGTCCGTTCTAACCATCGCCCCTATGTCGGTAGTTAGCCT
TCTCCAGGTCCTAGCTTACGCTTCCCCGTTACGTGTCGGTGTCCTTACTGACTGTCGGCCACGACGTCCGCTTGCGCCGCGTTGTCCTCGTGTGTTTTCC
ATTGTATCATGTCTCCATCTAGGTGGCGGAGTACTTTCCTCCATTTCCCTGAATCGGTGCCCGTGTCAGCCGTGTACTGTTGTACGCTCGTTCTGCTTTC
GAGCGCTGTGTTTGTTAGCTCCATTGCCA