Description :
From Genome Similarity Track
Location :
Scaffold_499:6282- 9209
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_499-snap-gene-0.9Guanylate-binding protein, N-terminal domain containing protein
Pytar_ATCC12531maker-par_contig_499-fgenesh-gene-0.1CAAX prenyl protease 1

Sequence
2927 bases(100 bases per row)
CCGTCCAGCGCACTCGTAAGGGTATAAGCCTCGGCCATTTGCTCTGCCTCCAGGCGGTTCTGCTGGACGACATGCTCGACCGACTGTCGGAAACTGGCGA
TAAACTCGCGCAGAACCACGAGACTCGCGAGTCGCGCGCACTCTGCCAGTGCAGAGGCGCATTTCTTGTAAATGACTGCACACGCGACGCTCGCGGCCGT
GTCTACTGACAGCACGACGCAGTATCCGTGCTTGAGTTCGAGGCGGGCATAGTCTTGGCGAGGCGACGCAAACTGGAGCAGACTCGCCAACAACAGTGCA
AGTTTCGGGAAACGGAACGGGAGCGTCGTGTCGCGTTCGCACTGCAGTAGCACCCGCCCCATGGTCGTGAGCACCATGGCGCACGCGAGGGGGGAGGATA
CGCAAGACGACTCGGTTGCCATTCTGTGACAATGACTCTAGAACGACGCGTCGCTTCAAGAATACTAAACCAGTGAAACGATCGAAAATAGTTGAGAATT
AGAGAAAAGCGTGGTGGTCTGTTTTACTGTGCCTTGCACATCTCCGTGTCGCTCCGCGTTCCGCGCGTGGCGCCTACCGCCGGGGGCGACTCGGCGTCCG
GTGACTTGAAGAGAAACTCGCGGCTGCTCGTGCGCAGGGCCGAGACAACGGCAAACGCTGACTCCAACTTCGGCGCTGTCGTTGTAGTCGCTGTGGTCTC
TACCGGTGTCTTCGTGCCCGTGGGAGACTTGGCCGCCCTCGCGGCGTTCTGGCTCTCGTACGCTTGGAGCTTATCTTCAAGCTCTTGGATCTCCCGCGCG
ACGCGGTCCATGTCGGCTTGCACGACTGCCTTCTTCTTCGTATACGCGAGCTTGAGCACGCCCGTGTCTGTCTTGGCCTGCGACCGAAGTTGCCGCGCAA
ACTCGGCTTGTTCCTGCTTGAGCTCATCTACGCGTTTGGCGTGGTCACTTTCGATGGCAAACACTTGCTGCACGTGCCGCGTCTTTTTCTGAACGAGTTC
CCGTTCCAACTCCACGACACGGGCGAGCAGTTCCTTTTGCTGGGCAAAGAGCGTGCGTTCTTCCTTGTGATGAGTGCGTTCCTTGGCCAGCATCTCGTCG
GTCGCACCAGTCATGGTCTCTTCAAGGCGCTGACGATCGGCCATAGCCTGCTTTTCCAATTCTTCCGTGCGGCTGCGCACCCACGCCAAATCACTGGTCA
TGGTCCGGATACGCACTTCTTGCTTGGCGTCCATTGTCGTCATGTCACCCATGAGACGATCAAGTTCGTTCTTTTTCGCGTTCAGCTCTCCTTGCAACGC
ACGTCGCAGTTCTGAGAGCTGCTGCGTCGACTGCTCGAGCTGTTCCTCGTACAGTTTCTTTTGATCGTCGGCCGAGAACGCCGCGCTCGTGTCTTGCTGC
TGCGCGAGTGCAAGTTCTTGGTCGAGTCCGGCGCGTTGCTCTTGGAAGGCCCGCATGTGCTGCTGGTACTGACGCAACACGCTGGCGCCATACGTCTTGA
TCGAATCAAACACGGACGCAAGAAGCGCGTTTACGAGCGATGCGTAAAGAGCCGGTCCAGCGCCTTGGGTCTTGTAGGCGTCCACAGCATCACGTAAATC
CGACTTGTACTGCGTGAGCAGTCCCAAGAGGCCATCCGAGAACGCGTCGCGGGGACGAGACTCGAGCGCCTGGGCAATCATCTCCAAATTGGCCGGTAGC
AACTCTTTCAGGAGCCGCTCGCAAAGCGACGCCGACAGCGCAGCATTGCGGGTCTGTAGGGTATCCAGCCGTGCCGCAAACTCCGATTGCAGAGTCGCGA
GTCCATTCTGGAAAAGGGTCTTCTTGGTCGTCTCGGGTAACTGGGCTTGCAGCGGTTGCAGACAGATGATCGCTCGCTCGAGCCCACGCCAGTGGGCCAA
CGAAAGCGCTCGTGCGTCGGTGGGCTGTACGGCGGCATCCTCCTCCTCGTCTGGGACGATCGTCTTGAGCTCTTGCTCGTACGCGTGTCTGGCCTGCTGG
AACGCGTCTTCAACGTCATGCTGGAGCAGCGCGTTTGCCGCCGTCTGGATGGCTGGCACTGCGTTCGCATTCCACGCTGACACGTACGCGTCCACGACGT
GGCCAAACTGGTCGCCTCGAATCTCTCGACCGAGCACCGTCTTGGTGGGCAGCTGATGGCCGCTGCGAGCCGAGAGAAACGGCGTAAACAGTTGCGTCTC
TATGGCCTCGATAAACTGGCCACGTAGCTGGTCGCGCGGGAGTGAAAACGACGCAGCAGCGCCTCCTTCGACCGCGCGGCTCAGTGCGACGCACGCGCAC
TTTTTGAAGATCGAGTGAAAGTACATGCGCTGCTCGTTGCGCGCGGCCACGGCGTCGCTGAAGCCGGCTTCTTCCGCGAGACACTTGTTCAGATACTGCG
TGGCCGTCATCTTGTCGCCCGTGTCCGCGTCGGTGAGCCACTTGATCTTGGCGTTTTGCTGGACCCAGACAAACGCCGGCGCGTGCTGGTGGAAATCCGC
GGCGACGCCGTCGTCGTCCTGGTTCGGCTTGATGCGAAGCGACGACGCGATCTCACGCACCCATGCGAGACGCTCAAGCGCCGCGGCGTCGATCTCACCG
TCGTCGTTGTAGAGCAGCGTCGAGCTGAGCAGCAGCAGCAGCGCACGCGCGCGGCGGGCGTGTTGTTCGTTCTCAGCCGCTGTGTTGGCCGAGAGCACGA
GGCGCGCGTCGTCACTGTTCGCGGCATTCGGCGCGTGCCAGAGCCACACTAGCACATGCTCAGCTGTGTCAGAAGGCTGCGTACTGAAGGCGCCGGCGTC
GGCGTGGAGCAGCGTCGTCAGGAGCAGCCGCTTGCCCGTGTGCGGCGGCCCGAACACGCCGAGCACGCGCACCGTGGGGGCTGTGAGCGTGCGTAGAAAG
GCGCGCGTAGCGTCGGGCACGACGAGC