Description :
From Genome Similarity Track
Location :
Scaffold_161:6280- 11036
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.13Tyrosine phosphatase
Pytve_DAOMBR484maker-pve_contig_161-fgenesh-gene-0.6Alpha-soluble NSF attachment protein
Pytve_DAOMBR484snap_masked-pve_contig_161-abinit-gene-0.27Adenylate kinase domain-containing protein 1

Sequence
4756 bases(100 bases per row)
CGCTGACAACCGCCCGCTGGCACCGCGCTGCTTTGAATCACTCGGAGATTATTCCGCCGTCCAGATCATGCAAACCTGATTTGTAATCCGCACTTTGTTT
TGGTTACATGGTTAGGTCCGACAACTCTCGCTAAGTTCGTTTTTGGTGTGATCTGCAAGATGGAGCTCGGAGCAGGTGGCGGAGATGGCACTCCGCTCTC
GGCGTCGCTGCCATTGCCGCTGCCGGTAGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGTACACTGCCATCGCTGAACGCGCCGCT
GTTCTTCGAGATCGTGGAGGACCAGGTGTACCTCTCGAACAAGTGCGACGCGTCGTCGTTCCCGTTCCTCGCGACGCTGCAGCTCAACACGGTCGTGTAC
CTCTCGTACGACGAGCTCTCGCGCGAGCTGACCGAGTTCTTCAAGGAGCGCGACATCTCGGTGGTGGGTGTATCTCGTGGTACTGTATGAAATAGTGGTA
TGGATCAATGACCGATGCTTATGTGATTCGGATAGATCCAACTCGGCATGAAGTATCGCGCCGCAGCCGCGCAGCTCAAGGGCTCGCTGTCGGAAGGGAT
GGCCAAGGAGGCGATCGAGTGCATCCTGGACCAGCGGCTGCACCCGATCATGGTCATGTGCAAGTATGTCAAGCATACGACAAATCTTTGTCTGATACAG
AGGGCAGATCCTCTAACACTGGTGGAGCGGCTACAGAACGGGTGTGCATTTCGCCGGCACGGTAGTTGGCTGCCTTCGCCGCCTGCAGAATTGGGGTCTC
ACTGCAACCATCGACAAGGTTCGTTGAGAATCTGAAGCCGGTGGCGGTTCGGTTGACTCATGGTGGATGGTGTCCGTTCAGTACCGCAACATTGCCAGCA
CCATCAAGACGCGGTTCGAGAACGAGCAGTTCATCGAACTCTTCGACGTCGACCTCGTCACGCTGCCTGAGCACCTGCCGCCGTGGTTCGTCTTGAACCA
GCGCCTCATGGTGTGCACCTTTATCACAATGTTGCAAATTGCGAAGCGCGTCCTGACTTCCTGTCCGCGTGTGATAGGAGGAGGAGCGATTAGCACTCGT
CAGCGGCGAAATCTATCCAGGTCTGAAGCCTGCATCGGCGCAAGTCGCGACAGCAGACACGGCGAATCACGACGATGAGGCTAGCAAGGACACCCAGTCG
CCTGATGTAGAACCCGCAGAGGTACCACCACCACCACCGTCACCGCCGGCAGACGCCATCCCCGCCTACCAGCAGTACTATTTCAACGTGCAGGGGCCGC
TCGTGTCCCCGTCCGTCACGTTCTCGGAGAAGAAGAGCATTATTGGCGACGACGATGACGACTAAAGCTGCCAATCGATACAAGTCCAACGGGACGATCT
TCCCGTTTCGTGTAGATTTGGTCGGCAGATGCCGATCGATGCAAAATGGACAAGGGTAGGCGCTACCCTCATACCTTCTGGCAAGCGTGGCCGTGCTGAC
GCAAGATGCACAGAGCAGATGCTTTAGGTCAGGTCCTGGGCGACGTCGGTCTCGCCGACGATGCTCTCCTTGACATGCAGCAGCAGTGTGATCTTCCACG
GCTCGATCTTGGAGATCGTGTCGAACTGGTACACGGCGTCCGCGAACGCATCGGCGTTGTAAGCCTCGAAGGCCTGAATCATGCCCTGTTTTACGATGCA
ACACGCGTTAGTACCCACCGCTCGATTTACAGCACACAAGCTCAAGTATCATGGCGACACATACCTGCAGGAATTTGCCCTCCCGGCTCTCGCCGAACGT
GTAGTCAATGTCTTGGAAGTCGTTCCACTTCATCTGCACGAGCACGAGGTCCTTGGTGGCAAGCGCACAGATGCCGGCGTTCAGCAGATGGTTCTTCGCG
TTAAACTTGAGCAGGTTCGACTCCATCGAGGCCTTCGCGATGCTCTCGTAGATCTCGAGCGCCGCATCGTACCTGTTCACATTCACTCGCCAACCATCAG
CGCCAGAACGGTCTCCTCTAGTCTAACACAGTCGCGACGACGGTACCGTTCGAGCTGCGCAGAGAACTGCGCCACCTTGAGCAGCATGTTGTTCGCGGAC
GAGGTCTGGTTCTCGCCCGTGAAGTAGTCGGCTGCCTGGCGGTACGCCTCGAGCGCCTCCTCCTTCTGCTCTTGGTGCTCGTAAATCTCGGCGATCTGCT
TCTGCAGCTTGGCCGCGTTCGAGAAGCGTCCGGCGTCACACAGCATCGAGATCGCCGTGCGATAGTACTCGACCGCATCTAACGGTCGTTGCAACATCAG
CAACAGTTCCCCACACATCCGCCAAGTTAATGTCTACGTACCGGTCGGGTTCACCTTCTGCAGCGCGTCGGCTGCTTGCTGGTAGAACTGCGCGGCGCGC
GACGACTCCTTCAGCTTCATCTGAGTATGGCCAGCATCGCGGTCAAAGAGGAGGTTCGTCCACATCGCTCATGCACAAAAGAATACCTGGCAGTCAGCGC
ATTTCTCGTACGCATCGGACGCCTCCTGCCCTGCGAACAGAAACAAATAACACACAGCAGCGTCAGTCGGATCCTCGACTGAGAGAACAGGGGGAGGACA
CCGTCGAGACGCACACTTCTTGGCGATCTTGAACTGGTTGCCCGCCTTCTCGAACAGGTCGCTGGCGTCGTCGTACTTCTGCGAGCCCGAGCCGAACGAG
AAGAAGGACGTCTTCTTGAGCGTCTTGTTGCCCTGGGACATGTACTCGACCGCCTTCGCCTCCGACGACATGGTGGCCGCGCTGGAAAAGGTCCTCTGCT
GCTCTTCGCTCGCCTTTGCCTTCTTCCCACACTGGAGATCCCACGAAACTCCGACCGACACGACGAAAATACGGGAGTCGAGCGAAAGTAAGGTGGCCCA
CAATATATCATGTCTTGATATTATGTGGTTACGCGGAATTAGAATGAGTGATATCGTGTCCGCTTCAACTTGACAATGCGAGTGATTGTCCGCATTAAGC
GAGGAGATCCCTACTGCTCGAGCTGGTCCCGCGCCTGCTGCTGCTGCTGCTCGCTGCGCTCCATTCTCCGTCGCCGTCGCTGCTTCACCGCGTTCACCGC
CACCTCAGCGAACGAGAGCCGCGCGGTCTCGGTGCTCCGCGTGAGCGTATCAAACCGGCTTCGCGCGGCTTCGAGCTGTTCCCACCCTCCACTGACCTGG
CCGTCACCATTCTCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAGCACGGATACCCGATCCGCACGAAGGGCTCATCGGTGCGACTGCT
CGTCGGAGCGTGGCGGCGAGTCCGCAGTCAAAAGCGAACGCTGCAGCCACATCGTCAGTGTCCTCGCCAAGCAGTGTGAGCGCGAGGAAGACGCACGCCG
ACGCAGCCAGTGGCACATTCGGGAACTTGGGACGCGCACTACCCAGCGCCAGTAGAGCCGTCTGCAGTTCGGCGCTCAGCTCCTGCTCGAGTCGGCCGGG
GTAGTTGCGAGCAAGCGCGGCGGTGACCTGAGGAGGCAGCTTCACGGGCAGCTTCAGCCGCGCAAACTGCGCAGGATCTGCGAGGAACGCGCATCTTGCT
GATTCGGAGGCGAACACGAACACGCGCCGCTCGTAGCTGGCGCGGAAGAAGACGCTCCCCTTGACTAGCGCTCCCCAGTCCGCAGGGCCTTGACCCCGCG
CGAACGTCACTGGACAGTAGCCGCGCAGCTCGGGGTAGTCGCAATCGCTGACCGTGATGAGGCTCAATATTGACGCTTCCACCGGCATTCGTTCGCGGGT
CTGACGGGCTTTGTCCGCAACCTCTGCTGCGAGATACGCCGGCGGATCGGCTATGAAGACCTCGAGGTTGGCTCGACTCGAGAGCCAGAACGTGTGGTCG
CCAAAGTCGACACAGAGCGAGCGGTCGTTGGCGTGTGCAGCCACAGCATACCGCCCAGCACTCAGCTCGACGGGACAGAACGTCTCGAAACTCGGATGTT
GACGCGCGACAAGACTTCGGAACGTGCGGGGCACGTCGGATGCCTCGGCCGCCAGCCCGGCGACTTGCCGCTGGCGNNNNNNNNNNNNNGTACCGCCGAA
GACTCGAGAGGTGGCGTGCCACGACTTGCTGGGCTAATGCTGATAGCCTCCACAAACTCGAGGCGTCGGCATCGAGCTTCGTCACGAGAGCATCGCCATA
TGAAGCCGTCCATTGTGAGAGCAGCTCGAGGCGGCGGCGCTCCCAGGTCGCAAACGCCGCAACAAGTCCCTCCCGGTCGATCAGCGTGTCGATTAATGGC
GTTGAGTGGGCTTGCCGTCGACCCCACGTTGCTTGAAAGCTCGCATCAAGTACGATCAGCATCCCTGGTTCCACGTGGACACTTTCGCTGGGAACGTGTT
CATCCGGAAACAGCACGAAATCCTCGAGTATCCAGCCACGAGCTTGGCACTCGGCTGACTGCAACCGCGCGAACACTGCAGCACGGGACGTGGCAACATC
CGGCGAGGCGTCGGCTGCGTCCATTGGCTTCAATGACGACCAAAGAGCGGAGCCTCCGAGGCAGCTGCGCACCCAGGAAAGCGCCGACGTCGGCGACACC
ACCACTGCACCTGTCGCGCGCGCGAGCTCAAGGGCCAAGCGTGCAGCTGGCGTCTCTGGGGAGCCGACAACGCAACACGCTAGCGCCACGGGCGGAGGAA
CGCTCTGTGTCTCGTACACGAACTGCCAAGGTCGAGCAGCAAACTCGGCGGCAGCC