Description :
From Genome Similarity Track
Location :
Scaffold_1409:6280- 7754
Transcript NameFunction/comments
Phypl_g13344hypothetical protein

Sequence
1474 bases(100 bases per row)
ACTGTGCTTAGCTGACATTGAGGCGGGCGTGAAGAGTGAGCTGGCCACCCTCCGACGACCGCGGGATCCACATCAACAGGGAACCACCGCCCGTACCAGG
CAGTCCAAGGAGACCGGGACGCCAGCGGTCCAGGTACAACGTCTTGTCCTGCAGTTCCTCGACCGTGGACGTCCACGTGACATTGCCGTTGGAAGgcacc
ttcacctccttAATCGTGTCACCTCCGGACTTGATAACCACGGACACGTCATAATTGTCCACGCTCTCGAAGAAAACCGTGACGGAGCcgtcgcccttct
tcttccagacGCCGTAGCTGCCCAGGAATGCCTGGTCCACTGTGTTGAGACCCAGGGCGTCGTACaacgtgccgtcgtcgatctcaCCCAGGTACTCGGT
GGGGCCACAGATGGGCTGGACGAACTCGGAGGCCATCCAGGCAATACCCGTCGGGTCGAACACGGACAGGATGAAGAGGCCGAGGTTGGAGTACTCGAGt
gccttctccttcttcacgacgTTCTTGCCCATGTCGGTCGTGCCGTCCTCAATGAGCTGGTCAATAATCACGCCGAGCGTCTTGCGAAGCAGGTTACGGG
TGTCGTACGCGGATGCACTCGTCTTGTTGGTCCAGATCTGACCCAGGCAGTGGTTGGTGACGATGGGGATGTCTTCCGTGATGATGGACGACTTGCTCAC
CGCAACGCGCACGTCGTTCGCGGCGGCGTTCGGGGTGTTGTTGCGGATCTCGTAGACCTTGCCCATGACTCGGTTCGTGAGGGTCTTGATCTCGTACCCG
CACGTTCCGTTCTTCGAGTTCAAGAacgtgtccagctccatggtggtgctgtcgagcgTAGTCGTGTTGAGCGCGCCCGATTCACGGAGCATGAGCATGA
CGTTGTCCGAGGACGAGAAAATGGCCTCTCCAACCATGACCGCCATCATGACAATGGCCGACACGACGGCAAGGATGGTGGCCGAGAACTGAAGCTTGGG
CGGGATCTTGATGCCGAGGCACGAGCAAATGGCAAGGGGCAGGTCCAGGATGgcgatctgcagctggaaAGCCTTGTCCATCAGCTTCTCCGTGTCCGTC
TTCGGGATCACGGTCTGCTTGTAACGCAGGTAGTAGATAATCGACTTGACGGCGTTCACGACGTTGATCGCGCACGTAAGAGCGAAGTTGGCGGCCTTGT
AGGCGGCCACAAGCGTGCCGAACACACCCAACGTCGCGGCGTTCAGTGCCACCGCGACCACAGATGCAATCTTGGAGATGATCTCCTGCGTGCAGTCAGC
GTTCTGAGGAATGCACTCCATCAAACAGTCCAACGGGTAGTTGAGCGGACACTGCGTGACGCACGTGTCTTTATCCTTGTTGAAACCGGACGGGCACACG
CCCTTACTGCTCACATCGAACTTCTTCTGGTAGCAAGCGCTGTCGCCGGCTTCGTCGAGGGGGCCCACCCAGTT