Description :
From Genome Similarity Track
Location :
Scaffold_2310:628- 2492
Sequence
1864 bases(100 bases per row)
TGAGAGGATTGCTCAGCGTCGTCCCACCGGGTGAGGCACTTCCCATAGACGCTGGTCCTTGGGATGGCGTTGGTGTCGTTACCATCGGAACCGCCCACGC
CGGTCCAACCGAACTGACTGATTGAGTGTACGGCATTGATCCCACCGAAGAGAAGGGCACAGAATGAAAGCTCTGGGTGGCTGCCGGTGGTGGCGGCGTG
ATCGGAGCGTCGGCGAAGTATCCAGCTCTTGTCATGAGAGCTCGATCGGTCGTTGCAGCTTGTGCTGGTATCGTTGTCACCGCTAGCTGCGGTGCGCGTT
GCTGGAGTGGCTGGTGATGAGTTTCCATCGTCAGTGATGTTGCGATCTCGAGTGCGGACGCTGGTGGCGAGACGGGACGCGATCGCGTTGGAGAAGAGCG
AGCTTCGGACTCAACCTCGTCATCGTCGATACAAATTACCTCTGGTGGGTCGTTTGAGCGCTTGCGCTTGAGATTCACGTTGGACTCGTGTTTTCCATGA
AACTGCGGCAGCGTGGTCGACGGCTTAAGATGTGAACTCCTTCCGTTGGTCTTGGCGGCATTTTTGGTGGCTCTGATGTGCTCGTCCCGCATCTCTTGCA
CGACACTGCGAAAATGTGGCGACCACTTGGCTCGTGAGAGCATCTTTCCCGAGGCACCTGTCCACCCAAGAAGCATAACAGTAAATATCCAGTCTCCAAT
CTCTCAGATCTAGCAACGCTGATGAAAATACGTACCGTCCAAGCGGTACGTTTTGTGGCTCATGGCCTTTTTGACGCCATTGTGGATATCCACGAAGCAC
TCTCGACAGAATGACAGGTCACAGGCTTCACACCACAATGCGACGCGACTCTCGTGGCACTGAGGGCAAGCTACAACATCGGCCCAACGTGTTAGTGTCC
AATCTTCTGGTCTTCCACCATCAACTGCTGCGGCATTGCCAAACCTTTCGTGATCCGCAGTATATGGAGAGTTTCATTGGGTCCACTGTGGTCGTTCACG
AAGCAGGAGGAGCACATGGCCTTGTCTTTGAACGCACAGTTGGGCTGCAGACACACGACACTCGAGAGCGCGCGTCGGTGGTTGGCTGCACACGGCGCAC
ACTCGGGGAAGCCATGGTCTATACATCACGCACCATTACGATGGTCAGACACGACGTTGCTTAGCACAGGAGAACCCAGTAAACAAACACGTCACCTTTC
TGCTCGGGATGCTGCAGCTCCTTNNNNNNNNNNCGCTTAGCACAGGAGAACCCAATAAACAGACAGGGCACCTTTCAGCTCGGGATGCTGCAGCTCCTTT
CTCCGACCTGGTTGGTCGGCGTAGACGCGCTTCACGAACGCCGGCAGTTCGCTAAACCATCGCCGTTCGTGCTCGAGCGCCGGGTGCTCGGCAGCCACTT
CGGCTTCTGTGTCCGTAGTCGCCTCGATGGAAACCGTTTCGTCGTTAACGGTCGCGTCATCGCCATCACCATCCATGACGATGTCTCCACCCGTTGGGAG
TTCCACAAACCGCGGCGGCTCGGGGGCGGCGGCCTCCTGTTCGCGCACTTCATCCATCGGCGCGTCCCGCACAGGACCGTCGTCCTGCGACATGGTCCCT
TGCGAGCTATCGTCCGTGGCGAGCAGTTTGTCGGTCGATTCGCACGTCATGAGGGTGTCTGTGTCGGCATCGGCGCGTCCGTTGGCGTTGGTTTCCGTCG
GCGACAGCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTCTCGGAGCTCTTCGGTGCGACTTGAGCAGCCATGG
GGTTCTCGTCGCGCGGCGTGGTCCCACACACAACGGTGTTCCCGTCGGCGTCACCAGTGTCCAT