Description :
From Genome Similarity Track
Location :
Scaffold_2962:628- 2340
Sequence
1712 bases(100 bases per row)
AAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCTTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTC
GTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCTTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGCACTGGACCG
CGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCGT
CAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGAACCGGTACGGGGTGTAACTTG
CCGTCATGTTCTAGCATTAGCGTAGTGCTCAATGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTG
AATGTAAAACACTCGTCTTCAATTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCA
CCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGATCGTTGGAAACGAAAGCTCGGTGA
TGGCAGCAAGCTTCTTAGGATCAGCCCTGATACCTTCTGGCGAAATTTTATGCGATAAACAGTCCACCTTGAGCTGGCAGAAGATGCTCTTGGTGAAGCT
AATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATTCTCGCCACCGAAGCAAATGTCATCCACAAAC
GACCGTCGATCAAATACAGGTATCAGCGATGATTCATCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGG
TCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCAT
CCTCTCCGAGTATTCAAACCAACCTTCTTTAGGTTGAACAAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCA
AAGGGCATGCGTAACCACTCAAAATGTCCTAGTGCGCAGACGAACGCCGGCACTTTACGCGCTCGCAAGGTCATAATGACCGCCCAGAAGCCGCTTGCTG
CATCCAGCGAGCAGAACCATAGATAGCGCTCGAGATATGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTTACCAT
CTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCA
CGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATAT
CGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTC
AGTCGACAGCTC