Description :
From Genome Similarity Track
Location :
Scaffold_107:62794- 66786
Transcript NameFunction/comments
Physo_142025reverse transcriptase

Sequence
3992 bases(100 bases per row)
GAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGT
CGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATA
ACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGA
TCTGCGCGATGGGTTCTATCAGATCCTAATGCGTGAGAGCGATATCCCTCTCTTGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATG
CCGCAGGGTCTGAAGAACGCCCCTGCAACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGT
TCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGAAAGCCGCTTGCGCTCATGCGCAAGCACAAGCTCTATGC
AAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGCCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTG
ATCAATGAGTGGCCGACGCCGCCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGA
TACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGTCTTGACTGAGGC
GCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGCTGATGCAGCACGATCACGAG
GGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCGTTACCATGAAGTACGCAC
TCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGGTCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCA
ACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACATCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGA
CCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGGAGGTCGCGTACG
CGCACGACGCGGACGCGAAGCTCATGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCG
TTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTTCCCAATGACCATGACCTGCGACTCAGGATCATG
TATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTATAAATGGG
TGCGTATGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTG
GCAGTCCATGTCCTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGCCTTTGTTGACCGCTTCAGCAAGATGGTACAT
CTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGG
ATCGAGACCCGCGCTTCACTACACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGG
CCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGTCGATGGCGGAGTTCGCC
ATCAACAACTCGGTGCATGCCTCGACCGGTTATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTT
TCTTAAGTGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAACAAGCAG
CACGCGTCTGTGCAGGGCACAGGCGCCGACAAGAGCAAGAAGAAAAAGAAGAACGGGTCTTTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCG
GGCCTACTGGTAGAAACGAGCTGAACGAGTTCAGCTCGGACGTAATCAACTTCGATCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTCC
AGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGTTCATTGGTTTTGTTAGCAACTCAAAACC
TGCCTAAAACATGCGGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGC
TAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGTGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCG
GAAGCCCCAGCGGGAGCGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACTCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCT
GCGAACCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTCCTGCTTCAGAGTGGCGAACTCACGGCTTTGAAGCTGCTCCACAGCAGCGACCTGCTCCTC
GAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGAT
TGTTGAGCGTATTGTGAATTATAGTATCCCGAAAACGAAGCGGCAGCCGGTTCGTTACCGTATTCGTTGGAGAGTGTTTCCGCCCCACCAAGATACATGG
GAGCCGCGGGACGTCCTGCTTGCAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGTTCACCACGCACTGCCGACGCGAAGGTAATGCGAGCGCTGTGAT
CACCTACAGCGCCCGAAGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCATGTA
CCCTTTTAGGGCGCGGTCGCTCAAGCGCACCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAG
GATCTGTGGAGCTGCTCCAGCCTCCCACGCGTCGAGAATGTCTCGAAGCGCTCACGGGCTTAGCCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTT
CTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGAGAAGGGGTTTTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAG
AGCCCGTTGTAATAATCGCGCCTTTGATTGTTAACGGATCAAAGTGCTGCTCATCCGCAACAGCATCGTCGTGGATACCGCTGCATACGTACAGCGGGAT
TTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAG