Description :
From Genome Similarity Track
Location :
scaffold_4:62782- 64885
Transcript NameFunction/comments
Pl_112893putative malonyl-CoA decarboxylase

Sequence
2103 bases(100 bases per row)
AGCCCACCGAGTCCAAGATTGCCTTCACATCCACACCACTAGAGACCCCCACATAGATGACAGAGAATGACAGCAGTGACAGCACAATGTGTGTGCAGAT
GCCGACGCGGCCATACTCGATGGCGAAGGTCTTGGCTCGTTGGCGCCACGACTGTGGCTGAAGTTCGTCTGTTGGTTGGTCAAGCTCCTTCTCCACATCG
TCTTCATTCTGCATCAATACAACAACAGCCACGCGTAAATTTCAACACGAGGCAGCCATGGTCGAGAGATCGCACCTTGATTGGGGACGAAGACGTTGGC
TCTCCACGTGTCAGCGGCTCCGACTCCTTTGAGTCCTGGGACGTCCTGCCACTGGACCAGAGGCGGGAGTTAGTGCTGCGACTCACAGCAAATGGCTGCG
ATGGGAAGCCAAGTACACGACGTGACGCAGCGGCAGCTTCTGCTCCAACAGGTCGCGGGGCTTGGGACCAGGAGACGCGCTTGATCCTGCTGTTAGGAGC
TATAGACGACAGAGATCGAGCCACGAGGGAGACGGAGCCGACGCCACGCTGCGTCACGCCGCGATACACGCACAAGTACCTCATTCCGCCGCGCAGCATC
ATGGAGAAACGAAGAAGATGACGACTAGCTCGATGATTGCGAGTGTCAGCCCTATATCATACACATTTGGGAAAACAGGAAAATGGCTCCGTTTTTAGTC
ATTTAGTTTAGAGGCTACACTAAATTGTGGTGTGTACCAAACACGACAATTACCATCGGACACAGCACTTCAACAAACTGCCGCAATTGAAGAAAGCGAT
CACCGGCTTCGATGCGTGGCTTGTGGGTGGCACGAAGCGTGCTCCGTCGCAATGCACGCGATGTGTTAGCTACCGATGCGACTTCCAGACTAGCGTTGCG
GTCGACGCACGCCACTCCGCGTGCGTACTTTTCCACTAACAGCGAGACTGGTACAAAGGAAGATTCGTCCCATCAGCGTCAGCAGTCCTCATTCCTACGC
AGCATCGACCTCAGCAACCCAGTAGCACAGCGTAAACTGTCCAAATTGATCCAGGAGGTGGTCAAGACCAAGGCTAATACCGGGGGTGAGTTCTCATGAT
TTACTGTTAACAAGAAGGATGGGATCTTGACTTGTGCTGCTTTGGGGCAGATTTCGTGCCCCAGGTGGTGATCCAGAGCCTCTGCACAACATACCGAGGC
ATGAACATTGACGAGAAGAAACAATTCCTACTTATCTTGGCGCAGGACCTGCATATTGATACGACCTTGGTGGGTATTTACTACTTGCAATGGATACCTG
TTAGTGCTGACATTTTGTTACTGCTATAGGCTCTGCAAAGTGCTGTTCAATTTGAACAAAATATGACTAACGTGAAGTGTGCTCGTAGTGGCTTGATCGA
CTGGGAACATGACAATGTGGAGAGATACTTGCGCACGTTCCGCAACCTTCGTAACGCACTATCACCGCTCTATGAGGTAACAAGTGCTTGCAGTAATTCA
AGAGCTGACGATATTGACAAGCTAACAACGACGATGGTTACGATGTCAGACCTTCTTCCAGCAGATCTTATCGCAACGAGAAAACGGTATGCTGTTCTTG
GTGCACATGCGCGCAGACCTGTTGCAAGTTCTGCGCAAGAGCGCGACCCATTCTGAGATTCCTGCTCTGCGCTCACTTGATGCGAGCTTAAAAGTAAGTC
TTTAGCTATCTCCTCATCGATTTTTGCAGTGACTTACAACCTGTGGCTTTCATCTCTTATAGCAATACTTGGCATCATGGTTTAGCGTTGGTTTCCTAAA
GCTGGAACGTGTGACCTACGAGCATTCACCTGGCCAGCTCTTGGAGAAGATCATTCGCTATGAGGCGGTGCACCCAGTAGGCACGATTGCTGAGCTAAAG
AGGCGCCTCGGTACGTGTCGAATTAGGGTGATTGAGTATGTGCTCCGTTGACTAATAGATGTCAATTCCAACTGATACTTCAGGCAATGGGCGCCGATGC
TTTGCTTTTTTTCATCCCAGGTAAGATCGCTTCAATTGGAAGCTATTGAGGCTCAAACCTGACTTCAGGATTATGTCTTCTCGATTGTAGCATCCCAGAT
GAG