Description :
From Genome Similarity Track
Location :
Scaffold_879:6276- 7928
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_879-snap-gene-0.5G10
Pytiw_DAOMBR242034maker-piw_contig_879-snap-gene-0.8Steroid 5 alpha-reductase 3

Sequence
1652 bases(100 bases per row)
CATGTCCAAGTGGACGAAGAAGGGCCGCGCGCCCGCCGGATACGAATACATCCAGCCGGTGATGGACGCGCTCGAGCGCGAGCTACGCGAGAAGATGAAC
GAGCCGCACGAGGGCAAGCGCAAGTGCGAGGCGCTCTGGCCCGTACACCAGATCACGTGGCAGCGCAGCCGCTACGTATACGATCTCTTTTTCAAGTACC
AGCGCATCTCGCGCGACGTGTACGATTACTGCGTGCGCATGAAGCTCGTGGACGCCAACCTGATCGCCAAGTGGAAGAAACCGGGCTACGAGCGGCTCTG
CAGCACGTTTGCGATCAACGCCAAGAACTACAACTACGGCACGGTGAGCATCTGTCGCGTGCCCAAGCACCAACTCTCGGATGACCAGGTGATCCAGGAG
AAGCACGCCGGCTGTCGCGGCTGCGCGTCCGGCCCCGGCGGCTACCACAACATCTTTGGCAACAAGTACGGCCAGTACTTGGCGCGCATCCAGATCGCCC
GCGAGAAGCACGCGCAGGACAAGGCGGGTGCTGATGTCTGGGCCACGCAGGAAGAGGAGCAGAAGTACGACAACGACAGTGGTGATGATGCTGAAGAGGA
AGAAGAAGAGGAGGACAAGGTGCCACATAAGAGCGGCCGATCAAAGAGGAAGGCGGACGAAGAGCAGAAGGGTGAGAGCTCGGAGGACGAAAGTGATGGT
GACGAGGAGAGCGACGAAGACTCGGACGAGCCCCAGGCGACCAAGAAGCAGAAGAAGTAGAGAGATCTGAACCAGCAGAGAGCACATCGCGCTCGTGCCT
CACCAGGACCTTCAATACCAGCAAGCCCTCGTGGTAGATCTCTTTATCACAATGTTAGTATCGCAACTCTTTTTCACCACACGCCTGGCAGTAAGACCCA
ATTTGGCAGCTGCTCTCTCTCGTCGCCTCTAAACGTGCGATCGTACCAGTCCGAGTTGAGTTTCGCCGACACGCACTGGTTCGTGACCACCCAGGCGCAA
GTGAACCTCAGGTTCACGTTCCCTTCGCCCACGACGAGCACGAACGAGAGGTAGAGCAGCACCTCTGCGGCGTACAGCGGGCAGCGCACGCGGTCGAACC
AGTCGCCGTGGGGCACGACGTGTTGAAGCCGGTTGCGTCGCTTGAGCCGCGCGATGAGCAGGTTGCAGAGGCTCTGGTGGTAGCTCGCGACCACGAAGAG
CACGGTGCCGATAGAGATTACGCAACGTCGCCAGAGAGTTTCCTCGTAGTGGACGCTGGCGTCATGGTCGGATATGGCAGACAGACCCACGCACAGGTAG
TGGACGCAGCCCAACAGGAAGCCTAACGATGACACCTGTGGGGTTAGTTGTCTCCCATTGGACTCCATTGGATACGCGTAGCTACGAGTCCCGTACCTCC
AATGTGCATGGTCGAGTCGCCAAACTCGGTCACGACCAGCGACTCGAAGAACCGGCGGGTCGTGTGGAACGCAAATAGGCTCAGGAACACGACCGTGTCG
TGGTTGATGTGCACAGATTGGTCCTCAGAGGTAGACTGGAGAGCGTGTAGCACTGTCTGCACCATCGGGTTCTCCTGTGCGAAGAGCATGAGAAGCAGCA
GCGACGTGTTGAAGCACGCCCCGAGCAGGTAGAACCACGTCCAGTAGCTCTT