Description :
From Genome Similarity Track
Location :
Scaffold_86:62757- 64234
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_86-fgenesh-gene-0.22Uncharacterized RNA-binding protein C365.04c

Sequence
1477 bases(100 bases per row)
ATCGCCTGTCTGGTCCTCCCCACTGAACAGCAGTCGTtGAGGGGACAAGTCATGTCGTGGGGGTCGCCGAACAAGGaGGAGAAGTTCTACAAAGGAGCCA
aGAATGACACGGCGTGGAACAAGGACCTGCTCTGGAAGTATCATGTTGCAAAaGAGGTGAAGCAAGCTAAGGTGAACACAGGGGAGATTCCATGCCCAGA
CCCAACGCAAAAGATGCGTCATGTCCGGATGCGCATGGGGATCACGGGCACACTGATTCCGGACATTACACCACGATATGAAGGGGATGAAACGTCAGGC
CATTCCCAAATGGTTTTGCACAGCTCAGATAGCCGTGGGAAACTGAGGCTTGGCGACGGTGGTGATGCGAAGTCCaTTCCTAGTCGAGGTAGTAGGCGTC
CACGAGGGTGAGCTTTAGGCGATGGCTGATGATGTGTTCAACTAGCTCGGTCGATTCGATCGACATCGTCATCCGGAAGTCTAAAGAGCTCCGTATCAGG
CGGCTCGTTGTCAAGCTCGTCATCCATGCGATCGATCCGACTCCAAGATGTACAAGACATCcTCgAAAGTCAGTCTCGCTTACTCAACGAAAGAACGGAC
GAAGAGATCGCAGCGATGAAGTCTGCACTCGAGGCGGAAGCTCGAAAGCGAGAAGCTGCAGAGAAAAAGCTCCTGTTTCTGCGTGAGAAATTAGGAGTAG
AAGACAAGTGACAAGGCAAAGGCATAGGAATTACATGCAATTCTATGATAAAGGATGAAAACTCGACTAAGGTCTGCAAaaTGGTGCTTACTCAACACCG
TCGGTCTCTCGGAAGCGCTTCAGAATGCCCATGAAGAACGCCTTTGAGTTCTTCACCCGATCACTCATGCTCTTGTTGAACTCGTCCAGTGCTTTCTTGG
CAGTCTCGTAATCGAACCACGACAGGAAGTCGATCATGCGCTCATCGACGTCTTCACCTGACAGCTTTGAAGCTGGATCATCGATGTGCTTCTGCACCAG
CGCACGGGTCTTTTCGATCTGCTTCTCGCTCTGCTTCTTACGAAGTGAGTCGATCTTACCACGACGGAGctCTGACTTATTACCGCCGCCAGCGGCAGTA
AGCTCCACGTTGATACGGCGTCCGTTCAGCAGCGTGTGGTGGCGCGAAAGAGCAGCACCCAGCGCCTTGCTGTCCTTAACTTCGATGAATGCTGTGCCCT
TGAACTTCTTCGTCTTCTTGTCCGTGAGCATTCGCAGCTGAATCTCGCCCGCTTCCGCGAAGTGCTTGCGGATCATTTGCTCCGTGCACTTGAAAGGGag
CTGACCGACAAACAGCGTCAAGTGGATGCGCTTCTTCTTGACATCTTCTTCGTCTCCTTCTTCATCGCCcTTCTTGaCACTGCGCTTGCGCTTCTTCCCA
ATCTGCAGCTCCTCGTTCGTCTTCTTTTtCTCGTCTCCGTCCTTGTCCTCATCACCACGCGCCGCCTTGCGCTGCAG