Description :
From Genome Similarity Track
Location :
Scaffold_1150:6275- 10083
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1150-snap-gene-0.0Reverse transcriptase

Sequence
3808 bases(100 bases per row)
TCCATTTCTTCTTCTTGAGTCGTCTGAGCAGTTTCAGGGCGATTTTCCCAAGCTCGTCGCGCGTCAAACTCGTAGAGTAAAGCATCACATGACAGATCGT
CTTCAGGAACCCATTGAGTGTCGTCGTACCCGACCCATTTGATGAGATACTCGCGCTGCCTTCTTCCATTCCGTGTCCGTTGCTTGTACTTGCAATCGAG
CACCTTCTCGACTTCATATTCGTCATCGACACCTTCTTCATCCCAGGAATCTTCAGGAAGGAGAGCTTCATCAAACTCGAGCACATGATCGACTTCTATC
CTTTCTCTTGGACGTTTCATGCGCGAGACAAACGGCTTTAACCTCGAGATGTGGATCAACGGCAGAACTTGGCTCTCTTTTCGGCCGATCTTCAGCCGAT
ACACGGACTCGTTCACTCTCTCTTCTACCTGGTAAGGACCGTGCCACAAGTGGGCGAACTTCTTCGCGAGACCGTCCTTCACGAGTACATGATACAGCCA
CACGAGCTCCCAGGCTGATACTCCGTTCTTGTCGTAGACTTAGTCGACTCGTCAACGCGCTCATTGTTCATCTTCGCTCGCTCCTCCATCAGCTTTAGCT
GGATGAACTCCGCGTGTGCCATGGCCCGTTCATGCTGCTTGAACATCTTCTGTCGCCAAGATAACGCGTCGCGCTCCTTCACTGTTCCGTCCTTAGGAGG
GACAACCGCTTCCAGCTGAGTTCTTGCATTCCACCCATGGACGAGATAAAAACTTGTCTGCTTGTGCTGAAGGTTGACCGAGGTATTGAGCGCCAATTCG
AGTTGTTGCACATATTCGTCCCAGTCTTTCTGCTCCGCGTCCGTGATGTAACACTTTATCGCCCGGACGACAGTCTGCACCGAGCGTTCTTGCTTCCCAT
TCGCTTGAGGCCTATACGCGAGAGTTGGCTTTTGCTTCTGCTTCATCATCCGATTGAATCGCCGGAACACTGAACTCATGAAACGAGGGTCACGGTCGTG
TCGGGTCACTTCTTGCGCTCCAAACCTCTTGAAAATCCCCGACATGTACGCTTCCGCCACGGACTGCGCTGATGTGTCACTCATCGGGATCAAAACGATG
TAGCTGGTGAAGAGGCAGATAAAGCATAGCAATGCCTCGTTGCCATTGAAGATCTTCGGAAGCGGGATAGCAAAGTCCATCGCGAGCACTTGAAACGGGC
GCGTAGCAACCACGTTACCTCTTGACCGCCCCTCGTACCGTGGCTTGTCCGTCGCCGTCACGCAATCTTCACATGACGCCACATACCATTCGACATCGGC
GAACATACCACGCCAATAATAGAGGTGGCGCATTCTCTCAAACACCCTGCCAACACCTTGGTGCGCGCCGCCGCCAAGCTCCTCATAATAGGCGCAGAGC
ACATCTTCCTGCAGAACGTCCGATACTACCAGCCGCATCTTTGTCTCGTCACCTCGCTTCTTCCCATATGGGCAGTAGTACAGGACGCCAGAAGAATCCA
GCACGTAGAGATCACCAATCCTTGCGACACGCTTTAAAGCCGTGGACGACGGGAATGCATCTTCATCTCTTTCCAGGTAAGCGATCACCTGCCTGCACCA
ATCATCGCTGCGCTGCGCTTCCGCGATCCGTCTGAATCGTTCAGCTTGAGCTTCCACCAGCATTTCTTCACTCACGTGTAACGGTGTCCAGTATCTTGCT
GGCTTGGAACCGTCGCGGGCAGCTGCCTCATCCGTAGCCGCACTGGCATCCACTTCCTGAACAGTCTTCTGCGGCTTCTTCTTTCCCTTCGACGCGCGCT
TCACCCGAGAGCCGATCGAGAACACTTCACATCGTGGCTGAGCGGACATTTTGGTTCCAGGGGACTTCAGGGGTACCAGACTGGTCATCACGCCTCCTTT
GCCCTCAACTCCGTCAGCCATACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCAGCAAAAGAGGCTCGCTTAGCGCCCTCAACTCCGCTTA
CTTCTTGATCATCGGCAGAGCGGTACAGCAAGTCGGGGAGCGTGTTCAAAAGCTCAAGGTCCTTCACCTCCACCGCGTCATCGACTGATCCACGCGCTTG
CGCAGCCATAGCCTTCCTCGTCAACAGGTCAGCCGCCTGATTGTACTGCCTTGTAACATGTACCAGACTAACACGCTCGAAATTCTTCAGCAACTCTTTC
ACGTGATTCAACCAGACTTGCAGAGAAGGTTGATGGCAACGAAGATCGTCGTTTACTTGACCGATAACGATCCGTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCTCCAGCGCGCTAATCAGTCCATTGTACTCGCTGTCATTCACCGTGAGTCCATCCTTGACATCATATTCGGCCACGACCACTTTCCACT
CGGGCAGCTTCCACAAGATCATTGCGAATGATCCCATCTTCGGCTCTTTCACCCGAACCGCTCCATCGAATGTAAGCATATACCCGCTTGAATTCTTTTG
CAGTTCTGGGAATGGGCGAATAGTGGGGATGTCCTTCAATGTCTTCATAGGCGCAATGTCTTCCAGGATATCGTCCATCTTCTCAGATGGTGTGATCGAC
GCAGCTAGCACTGCCATCAGACCGACCGGCGTCTTGTCATTCCTCACGATAGTCAGTGTCCATGGGGAGAGCATTGCGGCCCACTGAAGGGTTCGACCAG
ACAAACTCTTGGACGTGAACACCCACTTCATCGTCGAGAAGCGTGCATACACTGTGATTGGCTGACCCAGAAATAGTGACTCGCAACGTGCAGCGTCTTC
AACAACGCCAGCACTTCTTGTTCTGCAGGTGTGTATCGAGTCTCTGCATCCTTGAACACCTTGCTCACAAACCGAACCGGGTGGAATGTACCATCGTACT
CTTGACACACTGACGCCCCAAACGCCCACTTGTTCGTGTATAGGATAATCAACAACTCGCGCCGGCGATCAACATGGCGAAGCAAAGGCGCATTGCACAG
CTTCTCCTTCAGCGCTTCGAAAGCAGTCTTCGCGTGTTCAAGCTGGCTTCCGTCACGCAATCTCAGGTCTGTGACTTCATACAACACGGCCGCGTACGTT
GCGAAATTCTCGATGAAACGATGGTAATAAACCAAGCTGCCGATGAATCTCTGCAATCCCTTCTGCGTCGACGGAAAAGGCATCTCCATGATCGAGTTCA
GGTTTCTTGGTGTACTTCGTAGGCCTTCACGGGAGATCTCATGACTCAAAAACTGGACCTTCTTCTTCCCGAACGAGCTCTTACGCAGGCTGACGGTCAC
TCCCCAGTACTCAAACGCTTCAGGCAAACACTCTAGCATCACGTTCATCTCCGACCACGTGCCAGAACCAAACGTGATGTCGTCGATATAGGAGCGTGGC
TTGATCACCGGAAGTACGTCCACATCCTGCGGGTCACCGCGATGGAACACGATCCCTCTTCAATTGTACGTCAATGTCGATGCGTTCTTCTTCATACATC
GATTCCAAAGCATTCACCTCGTCCTCTGCCCAGCCGACTACCTTGAACTTCCCAACACGGTTACTCAGCCGCCGGACCATGCTCCAGAGCGCGTTATCGA
TCATTCGTTGGTATATCTGCGGCGCGTTCTTCAGTCCTTGAGGCATCCGTGTCCACTCGAAGTGCCCAAGCGGGCAGATAAAAGCCGTTACCAACCGAGC
GCGAGTCGTCAGCGGGACGGCCCAGAACCCGCTTGCGTTATCGAGTGAGCAGAACCACATGATCCCTTCGAAGTTGTCGAGCAAGTCATCGATCAGCGGC
ATAGCGTA