Description :
From Genome Similarity Track
Location :
contig_8:627224- 639778
Transcript NameFunction/comments
g1664.t1hypothetical protein L916_11591
g1665.t1dynein heavy chain
g1666.t1Dynein heavy chain 6

Sequence
12554 bases(100 bases per row)
ACAACGTCGAGGCGCTGCTGGCCAGACACAACAAGAAGTTCAAGGCCATGCACACGTACGAGCCCCCGCGGCACTCGGTCCGGGAAGTGAAGCAGGTGAG
ATATGAGTTTTTAGTACTTGTTGGAGACTTTTTACTGACATTATTTTTTAGTGGGAACGCGAGATGAAAAGGTCTTATTATGCTTTGTCGGCCGAGGAGA
GGGTGCAGGCAAACCAGGAGATTGCAGTCTGGAAGAAGCGACGAGTGGGGACGACCCACTAGAGAAGTTGGAGACGACAATTGTAAAGTTAGTTGATTTT
TATCTCGTCTCACATTGTTGTTGACTAGGTGTCTAGCATACAGAGCATTGCACAGCCACGGCGGATCCAGTGGTCGGGGCTTTTGTCTGTGGGAACGTCA
AGAGCGACGACAAAGTTGGTGGAGTGGCCTGTGGTGGAGAGTGTGCCGGCGCGGATGGAGGTCTTGTACAGCGGGCACTCGTACACGTCCGACGGCTTGT
ACTCTTCTCGTCGCATGGGCTTGAGCCAGATAACAGGCATGCGATCGAAGAGCTCGTTCGGGATGGACTCGGCCATCATTCGCGTGTTGCGGTCATAGCG
CGCACCTTCCATGAAGAGCCCGAAGATGTACACGCCGAAAGGCGGCGCAGCTTTGTACTTCTCTTTGTCCTGTGCCATGATCTCGCACGAGACAACGAGC
GCGTCAATGGCGATTTTTTGTCTCGAGAGAATGACTGCTTGACGGCTGTCATGAAGCCCTGTGGAAAGAAAAAGCCTGACAGCCAGAAACTCAACGGCGG
CCTTGCACGAGCCAGTCGTTGGTCAACGTGATTCGTATGACGAAGTCTTCTATCCAAGAGGCCAACGGCTTCAGGCACGGATATCCAGCATTCTCCCACT
CGCTTGGAATTTGCTGGATCAAAAACCCATTGTACATTTTCTCGAGCGGACCAGACATGACCACCAGCCCCTTGATCGCACGCTTGAGCATCTCAAGTGT
CGTCTTCATGACTTGAATCAGCACATTGAAGCGGATCATCTCCTGCGACAGGAACACGCCCAGTGAGTTACGACTACCGCCTGCTGCTTCTTGGAAGGTC
GATGGGTGCGCCTTGCTCTCCATGAACGCATCGGGCATGCGTTCTTGGATCGCTAGCACCATCTCCATAACAATGCTGTCATTACTCTGCGCGGCACTGC
CGCCGCCGCTATCGCCACCTCCACCCAGCATCTTCAATATCGTGCCCAGCAGCTGACCAGTTTCCTTTTGCTGGAATGTGATGTCTGCGTTGGCGTGAAG
ACCGAAGATGTCAGGGGCATCTGCTGTCGGCAGTGAGCTCACGTACTCGCGGACAGTAACCAGAGAGCCTTCGACTGGCGCATAGTAGAGTCCCGAGGTG
GTGAACTTGTACGAGTCGTCCATGACTCCTTTGCAGAAGAGCTTGCGCATGATACTCGAGTTCGTTCGCTTGTCCCAGCGGTCCGTTATGCGACCACCGT
AGGAAATGTCCGCTACCATGACGTTCAGCGTCAGGTACGGCACCTCTTCCTGTTCCTCCAGATACAGCCGTACCTGCTGCATTCCTGTCTTTAAGTCGCT
GTTCATCCACTCGTACGGGATGTTCCAGCCAACAGCACCAAACTTGCGTCGCTCAAGACACACAGCGTTGTAGAAGGCTAGCGCGAATAGCAGCTTCTTG
AACTCACGCGGCTTCGTGCAGCCTTCGAAATCGGCCTCTTTCATGTCAAGGAACGTACGTCCTAGGTTTGCCTTGATACCCTTCGGAGGCTCATTCGTGA
TCTTGATTCCATTCTGCAGGATAGGCACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGATTG
CTCCAAGATCTGCTCAAGCCGTCCTAGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAGCT
TCAGCAATCGGGCCTTGGCCTTGCCCAAGCGAGATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGATAT
CGGCGCCCGGTGAAAGTACGAAGATCAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCTCCAAGATCGAACGGTGGAGACTCGGTGAAGAATTTGCC
CAGCTCACGTCCGACGAACTCGCGCGTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATTCC
CAGGGTTCCGGTAGTGCTTCGGCATGCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGTAA
ATGCCGGAGAAGTATCCTTCATACCAACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCTTG
AACGGCTGAACTTCTCTTATCGCCCACAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACGCGT
AAATAATCTTGTCTTTCTCGAACAGCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAAACGTTCTTCCAGCACTTC
GGACTTGGTCGAGTTTTGAAGCGCATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATTGCGA
AGTAGATAATCGACCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATAACGAGTCTTAAT
CGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTCCCTTGGAGTTCTCAAGCATGTACAGAATCTTGTCTT
CGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACGTCCACCAA
CAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCTTTGTGGTG
ATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAGCACGGGCT
CCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTTTGCGATAG
CTTAATGATCTGGAGTGAGTTTGATGCTTTATACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGCGCCCCATG
GTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCGCTGGAAGG
AGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCAAGGTACGC
GATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCTCGCCCAGC
GAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAGTGTTCGTT
TCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCCTTAAGGTT
CTCCTTCTTTGGAGCAATGTTCTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATACTGCTCAGCG
TTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTTGTCCAGAAA
CTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTTCATTGTGACACCCACAAGTCTCGGGGGA
TTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATGCGGGCATAGCTTCATCCAAGTCCTTCTGA
CAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGTTGCTGTTTGTCAGCTTCTGCCTGATCCT
TTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTGAGCTCTTCAAGTTGCCTACGACTTCCTC
GGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACGCAGCATATCCACGTACAGTCGAATCAGC
TCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCAACACTGCGGTGAATTGTCACGGCCATGC
GGCACAATGTGTCCACATGTGTGTCAATACCAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGAGTTAAGAGCGTCTTCTGGCCATGCATTG
AACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATAGGAGAAAATGCCAATACCACATGCAAAT
TATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATGGACGAACGAGACCCACAATTTTCTCCAC
TTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTCATGAACGATTTGAGCATCCGAAAACAGG
AAAACGACAGGCTGGTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGCCATATCCACGAGTAATTTCGATCGAGAA
ACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAGTAGAGCATTACCGCGAGGCTGTCGCAAA
ACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTGATGTTGTACTCTTCGAGATACTCTGACA
GCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCATACAAAATATTCTCGAAGCGCGGGAGGCC
ACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTACCAGACGATCACGGAAAACTCGTGCTTC
TTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTGGAATACTTTAAAGATCACGAAGATTGAA
CGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCTCACAATAGGTGCTGCCATGTGTGTCATT
GCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGATTGGGATCCAAACCATGTGGAAATGACG
CATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTTCACATTTTTAAAGAACATTTTGGATGTG
TCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGCGCCGGCATATTCAAATCATCCACAAAGA
ATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCTCGTTTAGGTTGCGAGGCTTGGTTTGCGC
CGAGTAACTCATGGTAGACAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAGATTTGCCAACACCAGTCTCGCCACTATA
CAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCACCACCATCGTGAAATACGACGCTCCGGGA
CAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGTACACATTAGTCACGGTGTGCCGTCAGGA
CTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATGTTTGCTCCGACAGACCACGTAACAGCAA
TACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACAGGATGCCAGGAGATTGAGACAGCTCTGC
ATCAGGTTAGCATTGTTGCTGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACATGAGTCTCAATCAACAAGAGAAGCATATC
GCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGTTCGCGCCAAGGATGTCAATCCTACGTGCACTTGCTCCATATACACCA
TGCCACAACGCTGACAGTAGCCGGCGAGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGGGGCAGTTTGATTCGCTCACTGTTCGATA
AGCACAATGTCTTGTTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAAATGACCCAGTTGCGGTTGTCAGACTCAGC
GGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTGAACTCACCATACAACTGCCTGCGGAGATAG
ATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGTAGAGTTGAGTCAGCGCTCTCGCCAGCACGTA
TCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTCGTGAACCTGAATCGCCTTCGTGATAAATGAT
GGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGTTTCTGGAGTAGCCCATAGTCGACAAAAGCACCACCACAACGCCTGGGAAGAGGTCTG
CAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTAGGTACATTACTGTCTCGCATAGCTCGGATGAGAAGCAGATCCTCAGCATTTCGGGTT
CCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTGATCTTGCTTTGACAATTGCTCACTGGAGAGCGA
GTAAAGCTGAGTCATCTATGCGACAGCGGCAAAGCATTCGCAAACCCTCCGAGAAAAGCACGATCTCGGCAATTAAACGGTAGTCCGGCACCATCATAGC
AACGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCATTGTAATGAAAACGCCAAAACCTGTGTTGAGTCTAA
TGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTACCTGCTGAGCAATCACAGACAAAACTTCGATATCAAT
GCGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCCATAATCTTGTAATCCAGTCCATCGAGCAGTTGAAGAC
GACACACTGCACTGCAAGCGCTTTAGCCAAATCTTCGTGTTCTGTTTTGCCTGTACCGGCTGGTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCA
CCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGTGAATTGCCAAGATATTATATCCGTAGATGAAGCGCGTGTTGGTTTGT
CTAGCCACAAAGTTCTTCACGTCATCCTCCCAATAGTACCTGCAGCTGTCGAGTCCACTCAAAGTCACTCAGCGAAGATACGTTACTATCAACAATGAGC
GTACTACATCTCGAGCGTGCACATCAAATAGTGAGACAGCACCCATGAGAAATGCGTTGCAGTTTCGTCAGTGCCCACGCACAAGCTGCACCATAACCAT
CAATCGCTTCAAGCTGAATTGTAGGAACTCGCCAACAGCTTGCGGATCGCTGCCGCTCTCAACTTGTGCGATGGCTTCCGTGACATTTCGCGTCCAAAAG
ACCTGATCAACGAAATGATCACTCTGCGCTGAATATCCAATAGCCAATCTTTGCGATCAATAGCATCTTCGATGGGGTAGTTCATAAGCGCCTTGACACC
GTCCTCATACAGACTTGCGCGCATCGCTTTCTCCACCTCAGTAAGCCAAGCTCCACGGACCCTTTGCTATAACCTGATTAGGAACACAACGAGCTCACCT
TCACCGCTCACCATGGCGTTTACAACGTTACTAGCTGAACCGGGCGTATCATCGAAGCGCACACTCTTCATAGCGTCGAAACATTTGCCTAAGTGCGGCT
GAACTGCGCGTGGATCACGGGGTCTGTGACAGGATTTCCAGCAGCTCGTCATTTGATAGGAAGTAAAATCGTGGGAATGCCATGCGTTTGGTTTCGAGAT
AGTCCTCTAGGGACTTTTGAATCTCTTCAAGCAACTTGTTCGACATACGGAACTGATCCAAGAGCTCAGATCCACCTTCCACCGATCTAATCACACTGGG
GTCGTTCTTTGTTCGTAGCATAGTCGACTTCCAGTTTTGTCAACGAGTGCGAACTTTTGGGCCTCCACAGGAAGTTGCTTTTGAATGTCTTCGGCGCAGA
AAATGGTCTCCAAATACATCCAACTGCGCTGGCAAGCGATCCACTCATCCAGTGTGTCCGATAGGAGCGACAGCCGCTTGCCCCAGCGCTCCACTTCATC
TTTCACGCCCATGATAAACCGTGACCCCATCATTGTTTGAAGACCCACTTGATTATCTTCAAGCAGCATTAGAATATCTTCAAGACTTCCAAGGATGAAC
ACGTCGTTTTGGTCGCGGTGGCTTACGCAAGTGAACTCCATTTGCTCCCACCCATGCTTAATCTTGAGCAGTGATGCCTCAATCTGGGCCTCGCCGGAAG
CTGCTGCCGACATTTCACCAACAAGGTCTTTCATGTCTAGCACGTCATAGCTACGAGGTTTTCGAGTGTAAACAAAATACCAGGATACCAAGGCTGCCGC
AGTGCCTTGAAGATTTTCTCCCAGTGACGATCTTTTGCTGGGTTGCCCAGTTCAAGAACGGTAGGCATCTTCAGCTTGAATTCAGCCGTGCGGTCCTTGA
GCACGGCAGTAACATCGTTGCTCAATTTCTTGTGCAATGCGTAGGCATCCTTAAATGCTACAGCGACATCCTTTGAAGCTCCTCCGCATTCACTTCTACG
AACGGGCTAGTCATGGCACCCAAGTACAGCTCGTTCCACTTTTCAACTGCCGTCCAAAGTGAGTCGACTGTGGCAAAGTACTCTTGTGTTGCCTGCAGGT
TCAGGTACTTAAATGGCGTAAGATTAAACAGCGACTGATACTCTGTATACTGCTTCGAGAGTTCATCCAGCTGAGTGAGCCGCTGCTTCACACTTTCCAG
TTCATTCTTAACCACTGATGGATCCTCGAAGTGAGTTGCATCATGAAAAGTCCACCTTGCAGCTGGTTGTGCAACTGAAGTACTTGCTCGTCGAGGCGCT
GAATATTAGCGTCCAACTGCTGAGTCATCTCACCCAAACGACTCGTTACGAAAGCCTCAACAGCCTCAGTCTCTTCCTTATAGCTCTCTTGTACACCACG
TAGGTCATCTAACTGCACCATGTCTTCTGATGAGATGCGTACGCCGTAGGTACCCAGAAGACGGTACAGCTCGTCTACCACATTCGTGTTTTTTGCGAGC
GCTTTCTGCTTTGACTTCAAAGTTTGCACACGCTCCACATGCCCGGCAAACTCTTTCAAGTGTTGTGGACGCTGTAGCAGGGACTGAATGCGCTGCTTGT
ACTCACCCAGCTGAGTTTTACATCGTGCACGCGCCAAGTCTTTCACTAAACCCTTCATAGCATCCAACTTAGCTGTCGTCATGGGGATTAATGTCTGTTT
CAGTTTCCTGCTCTCCACGTGTAGAATGCCGATAGTCTGACCAGCTCGCATTTTTTCGAGCTCCTTCTCCCACGTGCTAATTTGTAGCATGTCTGCCTTG
AGCGTGGTGACCGTGTGGGCACGTTGTGAATACTCCTCCAGGTCCCAAACCTTGTCGTACTCGTAGATAGGCCGCACGTTGTCAAAGATTTTCACATATT
CAGTGCCTCGGCATAATCGCTTGCGATCTTGGCAACAAGTTCCTTACGGATCTGCCCGAACGCGACGCTGCTCGTAATGGTAGAGCCCACGTGCGGCGCG
TCCGCAACAACGTTTCCCACATAGGCAGCAAATGGTCGGAGGTATAGCACACGCGAGACTGAATTCACGGTGCTCACGATATCATCCGTCATAGCTATTA
CTATGTGCTGATTTGTTCACTTGTTGGGGCAAAAATGGTGGACTGCTCTCCGAAAAATAATGTCGTCTCAAAGAGTCCTGTCTTACGGGGAACTTTGTTC
AGCTCGCAAAGAAAGTTGGCGCAGCTCTGCACAGCCAGAATCACAAGACTCTCAACAGCGATGCAGTCAATAAGACGGATGAAGTCCGCAATCATGCCTG
CCTCCTCAGCGGCTCGGCGAAAGAGTCTCCGTCGTCGTTGTTGCTCCGCCTTGACAGCTACAATCGACTTGGTCTTTTCCTGACTGGTTCCCATTGCCCC
AGTGACATATCGGACATAAAATCCTCTTGTGGGTTTGACGATTTCGTCAAATTTTTCACATCGGAGCAGACACGCTGAATGATCGACTGCAATTTCTCAA
TGCATACCTCAAACTGCTTCGAGCCTTCAGCACGTTTAGTGCCCTGGTACTCCACAAAAGCCGAGCTTTCGTACGTCTTTTGAGCGCGCAGATCCAGCAA
AACAACACCCATCAGCTCAGTGCTCATCACCTTCTTTACCTGTAGCAAAGGAACACAAAAGCTTTCCTTCGCCAAAAACAATTTCGTACTCAGCCGCTTG
CGTTGGCGGCAGTAAAGCTTATAGCGCACGTTGGCACACCAAAGTGAAAACGCCTTGTTTACGAGGTAGTGCTTAAAGAAGCGTAACGACGTAAGCACGT
TGAACATCGTAGACTGACGCATCCACTCCGCCAACGCAATGAACTCGGAGGGACTGCCAGTGCTAACGTGCACAAGTCCGCTAGACGACATCGTAAAGTG
CTCATTCGGAGTCACGTCGTCCTGTGCAACGACCACAAGATCATACGGTCGGAACGTTAACCCAGTTTCCGCGCGATTCAATGCACAAACTTGATCTCGC
TATCCGATCCATTGCGCGCAAAGAAGGCGATAGTATCCTCGCCTGTCTTAAGAAAAGCTGTCGCTGATGCTGCCGCCGCTTCAGCAGCTGCGTCTGCTAC
GATCACGCTAGACGTCCCAGTTACCGGATCATGATGGCCTATGAACTCTGACGGACGCCGATCCCGCTGGTTGATAGCAGCCTTTTCTTCATCTTCTTCG
CCTCCTTGCTCGCCATACGACCGAGCAAGTGTAGTGCGGAGGAAACGCCGTGGCGAAGCCTCCCGCTTCGGTCGTCCAACCTCGCCTTCCCACGAAACTC
CAGTTGGCGCAGGAAACGCATCGCTCGCTGCTTTAGCCCCAGGTGAAGCCACTTGCGCCTCTTTTGCTGCGTGTCCAGGTGGAGGTTTGGCTCGATGCGG
CTTGTGCTTGCGTTCCGGGCTATGCAGCGTCCCCGGAAACACTAGGATCTTCTTTGGCGACGTGTATTCCTCTGCAGTAGTGAACGTGAACTTCTGGCTC
GCAGCCGAATCCACTCCCACCGTCATGGGCGACTTCATTGCTGCCCGTGCTCCAGGCACCGCCTTCATGGGTGTGTTGGACGGCAACGTGGCTCCGAATC
CCGACCCACCATCAAACTCGAACGTCGCGTCCAGCGTCAGGTCATAAATCGAGT