Description :
From Genome Similarity Track
Location :
Scaffold_150:6270- 8129
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.16Tetratricopeptide repeat protein

Sequence
1859 bases(100 bases per row)
AATGGCGAAACTGATCTGCGAGGGACTCTACGCAGATGTGATCCGCACGCCGCGCGGTCAGCAGTTGCTGCAAGCGATCGTGGAGTTCACGGCGACCGCG
GGCGACCATGCCGATGTGCATCTGTGCACGACGGTGTCGCAAGCGCTTGAGCAGTTCGTGCTCAAGGAAGCAGAAGAAGAGCGTCTTGGTGCGGCCTATG
AAGTGCTCTTTGTCGGTGCGGCGTTCTTCAACATGTACGTGCAAGCCAACTACACGGGTCCGGCGTTTGACAAGGACCAGCTCAACGACATCAACGCGTG
CATCGGTCGCATTTTCTACGGCGACAGCGAATACACAGACAAAAAGTTGCACATCGATGCGCTTGTGGCGCTGCAAGTCGATGGCGAGAGTCCGTTCTCG
ATCTGTGAGTATCCGCAGTTCCTCGTGCTCGGTCGCTCGCTGCTGCACTTTGTGGGCAACGCGCACCACAAGAACTGGTCGTTTGCGATCGGCGAGACAG
GCATCGCGAGTGACGCGCAAGACGTGATTTCGTCGCCAAGCATCGAAGACACCTCACTGCTCGCTCTCATGGGCCAATTGCAGTCAGCGGCGTGGTGGAA
CGCGCGTGCGGCGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGAGAGCTCTAACACACTCTGGTTCGAGGCGCGTCGCGGCTTTT
TCAAGACGCTGCGCAGCTCGTCTTCTGTGTCGGGGCTGTTTGCGTTCAAGAACTCCGAGTACCTCCGCGCGCGTCTCAACGTCGAATGGGGGCTCGCACA
GAGCCACTTTGACAAGAACAAACAGGGGAAGCGAAGCTTCGAGCAAGCCAAGGAAGTCAGCGGTGTGAGTGTGCAACTCAGCGGTTCCATGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAGCAGCAGCAGAAACGCACGCTGACTTTGGTGGCAAGCAGCAAGATGGCGCCGACACACAGGAAGCAGAAGAAGTGG
ACGAAAACGGTCTCACGAAAGCAGAGCGCGAAATCCAGCGCATGGTGCAGGACGGCGAGGCGACGTACCGCGCTGTGCACTTGGACCAGGTCGACCAGGA
CAACATCCTGCACGAACACATCCAATTCGAGGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGACGTCAAGAACAGCAACGCGAACGACGGGCTC
ACGCGCGAGGAGATGTTCCCGTACATCACGCGNNNNNNNNNNNNNNNNNNNNNCGATCCTGCAGATGCAGGCGCTCGTGGACCAGCACACGACCCGCTTG
ACCGTGCTCCAGAACAGCCTGCAGTCCATTGCCGACGCCGCGCCGGCCCACGAGCGAATGCAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA
GCGCGACCTCGCGGAGCGGTACCTTGCGATCGGCGTCATCCGCAGTGCGCTCGAGATCTTTGAGGAGCTCGAGATGTGGGACGACGTCGTTAAGTGCTAC
CAGATCTTGGACAAACCGACGCGCGCAGAGAAACTGGTGCGGGAGCGACTTGAAGTCGC