Description :
From Genome Similarity Track
Location :
Scaffold_553:627- 2178
Sequence
1551 bases(100 bases per row)
TTGTCGCGAGCCGTCCTTGGGTGGGCCGGCCCTCGAGGTGTATGGAAGCAGAACGCTTGTAGATAGTTAGAACAGACCAACACAATTGAAATATAACAAT
ATCAACTTGTTGGATCCAAGGCTTTTTCACGACTTACCTCTTCCATCACGGAGGCGGGCAGCTCAGCCGCCCTCCTTTCGTATCTCTCGCTCACCGCACG
GGCGCATGATTGTCCTGACACCCCCTCGCTTCGTCCCACCGCCTCCTGGTCCTCACTCGAGCCACTTCGCTGTAGCTCCACATGCATGCCttccgtcctc
gtcgctccGACGTAGCCCGCGCGCCTCCAGTTCcgagccttcttcttcaatgtCGGTAACTGGCGCGGCGGTTCCGACGATCTGAGTTTGCTCTGATTCT
GAGCCAAAGGCTTAACGAAGGGCTTGATCCGTGCCGCCCCGATCCGCTTTCGACAGGGATTCGCGCTCATCCTCATAGAGCTGCTCTGTCAGCAACTGAT
CAGCCAACGCCGCTTCACCGAGGGGACGGACTGGACCGTGCCCCAGACGGTTACCACCGTTCCCACTAGGGAGATCGCCCCCGACTGAGTCTAGACGTCC
TCGCCCAGCCGCCTCTTCTCGGACTTGGCGCAACTATTCACGCATCGCGCGGTGTCTAGCCGGATTTCCCGCAAGGGGGTACCGCGGCCTCGGAGCATTG
CTTCCACCCTCCATACGCCAGTTCGCCTCTCTCAGACGCTCCTCTTGTTCCATGTCTTTTATCTCTTGCAGCCAGTCTTCGTAGCGTTAACTGATCACCT
GCCACGGCGTTCGCTTCAGTGAGGCGTCTTCAAACCAGTGCCACACGAAACTGAACAGACTCACCGCACACACCACACACGTAGTCCACACAGCTTGACA
ATGGACAGTTAACCATTCAAAAAGGTTCACGTCTCCTCCGCCCGTAAAATAACAGTTACCCActagcaccagcaccatAATTCCCAGCTTGCCACGGCAC
AGCCACTCCGTTCCTTCGTACAGGTGCAGCATGCTGAAGGCGCCCGTCGAAAACAGCAACGTGGCCACCGACCACGGCATCTTTACAGTCCAGCGTGCAC
GATCAACCGTCCATTTGCATTCCACTCGTAGTCCCTTGTAGTATTTGACCAGCAAGTCCCGACCATTCTGGATAGTAACCGGCAAGAACACACACCAGTA
GGCGTGAAACGCGTCGAACCACTTGTACACTAGCCGTCCGAGGCCGTCCTCGTGTTCTTGATGCGCTTCCAACACTACCATCGGAGTGATCCACAGAGCC
AGATACATGCTCCATCAGCGGCCCCCACGCGGGCGGTCACGCTCGACCGGTCCCCTCacaataaaaaaaatacGTCGATAGCGGCGGACACTTATCGTCG
CAATCGTTGCCCACTTCTAGATGAAGTAGCTGACCACCGCGACCGGGCGTGCAGCTACGTCATGGAGCGATTGCGTGACCACCGCGACCGGGCGTGCAGC
TACGTCATGGAGCGATTGCGTAACCACCCAGAAGAGCACACCGCTCACCGC