Description :
From Genome Similarity Track
Location :
Scaffold_526:6269- 11252
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_526-fgenesh-gene-0.2DNA polymerase epsilon subunit

Sequence
4983 bases(100 bases per row)
CTTTTATGCCTTGCGCTGTTTATTCCACGCGACTGAACTCGGTGGCGTTCGTACTTGGACGATACAGCACGAAAGAAAAGTCGACGTGGAACGGACCAGG
ATGGAAGACCGCTACGGACGAGTAGCCCAACTGGAATTGCTCCGTGGCATCACCCAGAATCAACTACATGTGACGAATTAAACAAATTGAACAACACGGT
GAGACATTACATCATGCATCTCGGTAATGCTGCCACTGATCGCATACCACGTCCGGCAATGGGAAAAGCTGGAGGGACGAGTCAAAGGCCCAGTTGATCG
GGCAGGCCATGAGCGGCAGTGGACACAAGTGGGCTTGATCGATGATCGTTTTCACCAACTGCGTATACACCAAAACAATTCCGAGGTAACAATCCCACAT
GTCAGCACAGTAGGTATGTAAATTTGGCACCATCACCGATTCGAAACGTACGTGCTTAGAGACATCAACGTGCGTCGATCGTCTTCGAGCGCCGTCGTCC
TCGTCATCGGCATCAACGACGTCATCCTCATCCTGGTCAGGGAGCACCGGGAGAAGTGCATGTCGCTGCATCTTCTGGTGAAGATCGTCCCGGAAGATCA
CAATGTCTTGCGTGTAGTAGCGTATTCTAGCCAACACAGAGTAACGAGTCGACTCCAAAAGTGAGTTGACCAGCACAATTATCTAACACTTGCGCACCGA
GACTGGACAGGTGCTGACCTGCACGGATTCGTCGCACACGTTAAGTTTGGCACTCTTCGCATCAAATCCTGCGTGCAAATCGCTGGCAGCTACGAACCAA
AGCACACACCAAGTAACTTAGCAACAAGCCATTCACCTGCAAATACCAACAGTACCAAGGCTACGCACAGGGTGTCGAGGAAATGCTTTGGACGAGCCTG
GGTCGTTTGGTCCTGGGACGAGCACGAATTTTGAGAATTCTGCGAGCCGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAGCTCGTCG
AAGTACTCTTTCAGGTCTTGCAGCGAGTTGGAGCCCACGCNNNNNNNNNNCGCCGATCGACGACGACATGAAGTCGCCCATGAGGATAAACAACGAGGGC
ATCACGGCCTCCAGGCCCTCAAAGAGCACGTCGAGGTGCTTCATGACCTGTGGGTCGTCCAGGTGCACGTCCGAGAGCACAATGAATGTCGCGTGGTGGT
CTCCGGCTTCGAGTTCTCGAATTTGCTCGAGCTGTTGCGCAGAGACCTCGACGCCGAGCGGGTCAATGCCACTCAACACCTCCAGCGACTGCGCTTTTGG
TTCTGGCGGCGGAAAACCCATGGACTGAGGTAGTATGACATACACACAGAGACACAAAGGTCAGGTTTGTCCTCAAGAAAGACAAAATCGCAGAAACAAT
ATTAATGTGCAAGATCCTCACAAACGTACATGGACATGAAGCACATCGTCAATGACTTCACCCTCAACCAACACCACGCAGTTGATCGTAAACAGCCCAT
TGGTGTATGTCTAGAAGCCAAAATGGAAGATAACCGAATGCGTAACTCAGCAGCTCTAGGATAATAATAACAACAAGCAGTCACTATGCGTACGCACCGC
GTTCGTGAGGTCAATGTAGATGCGCGATGTGAGGTCTTCCAAGTACACACGCTTGCGCTCATCTTGGCCGAGCATCCCAATCACGCGCTTCACGCCCGTG
ACGCCCAGCAGCGACTCAATGCGCGAAAGCTACCAGCCAAAACACATGTCCACAGCATCAGTAAGATATAACAAAACACGGCAGTCAGCGCAGGAATTGG
AGTGTGTATCTCACCTCGATGTATTCGACGGTGTTCGAGACAGCGACAGCCGGCGGCGCAAACATTTTGTTTCGCTTCACACGCAGGTCCACAGAGATGA
ACCTGCACATACAGCAGCGCAAACGCAGCCTGTGAGTACATTGCAAAGTGCGTGCAGCGTGCATGACTAACAACAACGTGCCGATCGCGAAGCAGGTTGA
TGCGGTGCTCGGGGTCTGCATGGATGCGTCGATGCACGTCGCTCTTGAGCTCGTACGAGCTGGTGTGTGAAATGTAGTGCAGCTTGGGCGTCTCGAACGC
GTTGAACACCTGGATTGCGTCAAACTGGTTCTCCGACGACACTGCGAGCAGCGTGTCCAGCGCGCTCTCAAGCGCTTCAAGTGATACCACCGACGTCGTC
ACTACAGCAGAAAAAAAAAGCAATGTGGCAGTTAAGCAACCAACAGCGCCACCATGACCACCATGTGCTAGCGCAGCATATCATACGTACTCTTGCTTTT
GTCGATGCTGTTCTTGATCGCATAGATCACGTCGTCGAGCTCCAACGAAGGCTCACTGCAGATACACATGCACGCGTTCGTCAGCCATACAAAGCACCAT
CTATATACTGTCATACACAGAGAGAGAGCAGACGCACTTGGTGAGCTCCTGCGCGAGCCGCTGCAGCGCGTCGGCGTGCAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTGAAGTTTGCACGCGCGGAAAATACGCTTCGATGCCATTTGCGTGCCTATAAATTGCGGTTGCAAGCGAAAGTGGCGCGAACAAAATGGC
GGGTCACACCGACTATAATCCGAATATAAGGTGTATCACATAAAACTAGACTTCAAATCTGTGACGTGTGACAACTTGTCAACCGACATGGATACATTTT
GTAGCTCTTCAGTTGTTTCTCTAAAGTCTCGTTCTTTTCATTTCTGTTAGCGTTGCTGCACATAGCAAAAAGCACCAGGTCTAATGGAGAGTGGGCTGTA
TTTACAGAAGCAGTGTCTCTCTATGGCGGCACCCTTTTAGTTGGTCTGGTTGCCTCCCTGGCCGAGTCCAAGCACGTAGCTCATGTTTTGCGCATCGCGG
AGAGCCGAGGAATCGCCGATGGATTCAAAGACGCGCGAGTACGTGTGCCAAACTTGCGCACTCTGCGAGCGCAGACTCAATCTACAAGAGAAGACGATGC
AAAATGCTTAGCACACTGAGTTGCGTATGTGCAATTTTAGGATGCAATGTACCTTTCGTTGAGGAGTAGTTTGGCCAGAGTCAAGTCTTCGCATCTGCTT
GCACTGTTGTGAAATAGGTGGTAAGATACAATCTGCTCCTTTTTGCAAATACTTGTTAGATGCATCAACCTACCATTCTACGAGGAGCAAATCAACGATT
TCATGCTCCGTTGGCGTTCCACCGAGAATGCGGAGGTTGCCACGCACAGGCAAGAGCAATTTTGTCGCTGCTTCGTATTCGCCCTATACAAATAAACCCA
CAACTGGTCAGAACGACGAAATAATAAAACATGTGAGCCATTTTTTCGAACTCGAGACGCTCGTTACCTTTGAATATGCAGCAAATCCTTGACAAACCCC
GTTGAAGACGGCATCAAATTCGGCTATTTCATTTCAACGATAGCAACAAACATTCATTGTGAACTCAAAAAGAAACGAACTCGAGAAAGGGCCACTTCAA
CGTCAACGTAAATGCACTAACCTGTTGCCGATGAGATAAAGCTGAACTGGATCGGAGGCACGCCCAACTTTGCCTCCAACTGGACAAGATCCACGGATTT
CTCGGGGGCTCGTTGGATCGCAGGCACGGCATCTTCCTCAAATGAGGACAAAATGCTCTACGCAAACAAATTCAGACTGTGAGTACCCTCACCTCCATGA
CTTTTGCTGACGTCAGTTCTCTCGTTTGGAATCCGTACATAACACATGATCTTGGTAATGGGCGAAAACATGACTCGTTGTTCTTCCTCATCCTCCGAAA
TGGAAGTCCATGCATCGTAGAGCTGCTGACGCAACTCGGTCGTATCTTGGCCAGCAAAGTGCAGTCGCCAGAACAATTGAGTTGCATCACGTAGCGTCGG
TGCCGCATGCGGTTGGCTCACACGTTGCTGGAAGATGTTGACCTCGAGGAACTTCTCAATGCGGTCGTATCGTCCCAGATCAAGCAGGTACAGCGCCCAT
TGAAAATACATGTGGCGTTCCAACGGACCATCGTTATCAAACATCTCCTACACGTACAAAAACGTGGGTCAGTCCGTAATAGGAATCATAGACCACATTC
CAAATGGCAAACGCAAGCACGAAGTACTCTGTATTGAAGCGCATAACTGGCGCCGTGGTTGGCATTCCCACGCGCTTCGAGAATGTGTAGCATTGTATGG
ACTACAAGAAGGCAGCAAAAGAGTGACATTAGTGCATGTCGAACTTGTTTACAAGTGGCAGAGAACATATAAATCGTACATGCCCAACGATCGTTTCCGT
TCATCGAGATCGCCTTTTCAGTCAAATGCTCTGCGGCGTCCAACTTGCCATCCACTTGGAGGCCGTACGCTTGCATCGAAAGCAAGTGACTATAGCCTGG
GAAGGTACAAGCAAACAATACCGTTTAATGTGAGCCCCTCCCTGCATAGCCGCTTGTATATAATCCACACTTTCGTACCTGGGTCGTTTGGAGACCACGA
TGGCAGGCGGCGCGTGACGGTCGACAGCACGTTCTTGTAGTCGCTTCACTCAGGAAAATGGACAGCCACAACGTCAGTAACTCACAACTGCATTCCTAAC
CAAATGCAACGTACCCCAAGAGCAGGTAGAGGTCGAAGCTGCAGCGCAGCGCGAGCAGATCGCGGTGGTCCTGCAGCAAGATCGTTTCGTAGATGACCGT
CGCCTCTCGGTAGCGTCCATTCACCATGGCGTCGAGTGCGAGCACGTGCAGTTTCTCAGCCACTGTCGTGCTTTCTACAGAGATACAACGCATTAGTTAG
GCATTTAGCACGCATCACGTGAAAATGCACAGCGGCTGCATTACCATTCGTCTGCGCGAGTGTAGCGGCGGTGCTAGCTTGGGCTGCGGCATCGAGGGAA
TCTTGGTGCATGAGAGGCGAGAGGCACTGACTCGCGCCCACAAGCACATGGCCCATGAGGAAATTTTCATCGTCCTCCAGTAC