Description :
From Genome Similarity Track
Location :
scaffold_19:626896- 634257
Transcript NameFunction/comments
Plaha_PHALS_09701Nuclear transport regulator
Plaha_PHALS_09702dihydropteridine reductase
Plaha_PHALS_09703ferric reductase

Sequence
7361 bases(100 bases per row)
ATGGTGGCAGCAGTCTTGTCTGAAGCTGTCGTGTCCGAAGCGCTGCATCAGTTGTATAGTCCCGTCAGCTCTCCGCGCGTGCGTCGTCGTGCCGATTCTC
TTCTTCAACAGTTCCAGCGCTCTCCTCAAGCTTCAGTAACAGCGCTTGCCGTGCTTCAAAATCCTATCGTCATTACTGGCAATGCTGAGCACGATGCCTT
AGAACGAGCCAAGCGTGTGTTTTCGGCGTCCACGATCTACTTCTCTGTGGCTATGTACATTCGCAAGTACAAGTTGGATGATGTGTCAAAATGGACACTT
CAAGATCGTGAACAGCATGAGCTGGTGGTCAAAAATTTTGGTCAAATGGCTCAGAATGTCTGGAACGTGCTTACTGGGCCTTGTGGCACGCAAGAAGAGC
TGAATGTTCAGACTTATCTCGCTCTTACAGTTGCTGTCATTTTGTTACGCTTTCACGAACCTCAGGGCAATGCCACTGTGATTGATGCAGTAGAATGGCT
tgtgaaaaatcaagaacatCCTATAATTGATAGAACAACAGCTGCATTGTCGAATTTTGCCGTTTTGTTGACGCTTAAGGTGATTCCAGAGGAAGTGGAC
AATAAGCGCGTTAAATTTGCCAAATTTAGGCGTGATCATTGTGAAGATATGGTGCAAATATGTGCAGCTCACGTGGTACGACATGTTTTGCCATTAATTG
CTGGTGCGATTGATGCTAATGAGGAGCAAAAGCAGCTCGGAGCCTTGTTGCTCCAAACGTTTGCGAGCTGGGTGGAGCATGGTACGGTGCCTCCCGCTGT
GCTCATGGAGTGCGGGCTCTTGGACCGAGCGTTTTGTGACATGTTGTTGCCATCGTCTTCCTTGTCTGCAATGAATGCTGTTCGTGAAGTGGTTCGCGTC
TGTCAGCAAGATGAACATGCGCAGCTAATGGAGTGTATCATGCATAATTTTGTTatcttaagaaaaaaaatccaaGAATGCATCGCAGCAAACGAGAAGA
GCTTAGATTTTTGTGTGAATGATTGTGCAAGAGCGATCTCGGAGTGTGGACAAGCATTCATTACGTATTTTGTGGATTATACACTGAATTTACAACCTGG
ATCACTAGTGTATGAATTTCTCGACGCAATTTTGTTTTTCACATCACTGAATCTTTTTAATACCTCTCACGAGACCATGGACTTCTGGGTTGATTTTCGC
ACCTATATTTCTGGAAAATATGAACAGCGCATGTTTGGATTCGAGACGTTTATTTCGCGGCTGATGAATATCTTAATTGAGCGTACGGAGTTTCCAAAAG
GATTTGAAGATCTGTCGGATGCTGCAAAAGAAcgtttttttttgtttcgAAGCGAGGCTCGCAATGTCTTTCGAGCACTTGTTACAGTCTCAGTGGCTAG
CGAAGACAAGTTTATCGTCGATGCTATTCATGCTGTCTTTCAACAATACGAAATCGTCGATTCAGGATCTCCTTTACCAACAAATGTATGTCTCGTTTTG
ATAAATCTGAGCTACGGTTGCTAACGTCATATTGTGCTCTTATTGTGATATATCTGTTTAGTGGTGGCAACATACTGAAGTTTATGTTCACGCTCTGAGT
GCAGTATCAAAATCTATTCGTGAAGAAGATACGTGTCTTATGCCGAGACTGTTAGGTTATTTGTCAAGGAAGGAGCCCTCACACCGTGCACTCTTACGCA
CTATAACCATCTTCTTAGGTATGATCGGTCATTGGTTTGCGAAACATCCAGAGTACCTGTCAAattatgcatttgaaatcATCTTCTATGGCCTAAAGAC
TCAAGATGAACTTGAATACACATCCAGTCAGTACGGCCAAAAAGACCACGTAGGCGCTGTGGCGCTACGTAAGTTAACCTCTCGCTGTGGGTCACACTTT
TTTAATCCGCTTTGGATCGAGGCACTGGTGGATTTGTACCGTTTAAATTGTCCAATGTTGGGCGGATCTTCGAAAATATGCTTAACGGGTGATAGTGCCA
GGCTTATCGTGGACTCTATCTGCCGTGTCCTCACCACGGTGTCGTACAAGGACGCGCTTCCAGTAATAGACGAACTTGGAGCCATCATATTTGCGGAACT
TTCAGCTCGATGTAGTCAAGCAAACACTTATGATGAAAGCCCAGTCGAGTTTCTGAGCGAGAATCTTAGACACCTTTTCGTATTGGCGACCCGAATTTCA
GTGCAGTTAGATCAAAATACTCCACACCCAATTTTGTGCGTGTTACAAAGGCATTGGGAAATCTTGAAAGTAGCATTAAGTTTGTATGGCTGTTGTGAAG
AAGTGGCGGAATCGTTCTGCACGCTTTTGGTTGGTGTATTTGAATCACTACGATCTCAAGCTTTAAATTTTGCATCTGCTATTGTGCCGTCTTTACTTGA
ACAGTTCGCGAATAGTCATTATGCGTGTTACTTAAGCGTGATTAAGAGTATCATTGGCTGCGCTGGTGATGATGACGCTACAAGTGCGAGCTTAGTACGT
GTATTTACGATCGTCAGTGAGACTTCAATGAGTAAAATAGCTGCAGACGGCAGTGTTGACCAACATTCTGGCCTCACCATTGCGCTTTTTACGTTGGTAG
CAAGTTGTGGTACCCACCATCCATCAATCTTAGCTCGGTCAAACCAGTTGGAAAGTGTTCTGGCACTAGCACTGCATGCGTTGAAGTCCCAGAACCCTGA
CGTTGGAGCTGCTACTTTAGACTTCctatttgagctcagctctttGTACGGTCAGATCATTCGTACGCCAGATAGTTTGTTTCAGGGACCGGAGCTTGCA
GGCAAGTTATTGCTACATGAACAAATTCAGACGTTACTTTTCGAAAAGGATGTCCAGtaccatattctttttgctcttTTCAATGCTGCGGCAGGAGGAA
TGGCTCCGAACTTGATGGAAAAGATTGCAGAGGTTGTGCGGTCTTGCTGGGTTTACTTTGGACGCCAGCGCAGCGAAGAGCTGATTAATCGACTTCTATC
CGATAGAAACTTTAAGGGCTCCCAAGTGAGCGATCGCGCTCGAACTGAGTTCCTTAATTACATTTCTACTTCAATTTCTATGGAAAACTCGCGCAAGTTT
AAGCGCGTTTTAAACACGTTTTGCGACCACTTTAAGCGCACTCTTGCCGAGAGTGCTATGTTAGTGTAGAAAGTTCGTGACGGGTATAATGCAACGAAAG
GTAATATCATGTAGTATGGAGGCACAGTAATTCTATTTAAACGTGGCCAAGAATACGTGTCAAGTATACCGTCCTACTATTGAAATGAATTGTCAATGTC
CTTCCAGGACGTCGTGCCATATTCAGTGGTCACTGTGATTAAATGTCCGCTAGGTGGACGAGTGGCGTAAGTGGCTTCAGACCACTCTTGAATCTTCTCA
GCAATATCCTCGACCTGTGATGCATTAAGGTATGTTGTGTGAGGCTATTTAGAAAGATGATGACCAAACAAAAATCCATTAAGTACCTTTGTCCAGGTAG
AAAAGTCAGCCTTTGCCATAAACTTTCGGTTTACAGGCGTGTCGATCGTTATCGGGAGCACACCTAAGACTGACGAGCCTTCAGGAAGTTCACTTCTACA
TTATGTTTTAGAAAAACAGGAGATAAGTTATGCAGGTTTTACTGCAACCACAAGTCCTATATTTCTTACACAGCACTAGCGATCAAATGATGAGTAGCTG
CCTTACTCGCGCCATACGAGACCATACCAGGAGTAGCGCAAAGGGCAGCAGTGGCGCCCGTAAGAACGAGAAGCCCTCCGGGTACAAGCAAATGGCTCGC
CAAGTACGTTGCTAATCAATAAAGGTTACTATCAAACCCAAGTAACAAGAACTTCAGCGTTCTTACTCAGAAAGGCCGATTCGAGGTTCTTTACATGCAT
TTCTCTCAAGTTGATCAAAGAATTAGCGTCACGAATGCTTCCACCTGCCCAGCCACCAGCAGTACATACCACTGTGTTTAGCTTGCCACACCTGTCGTCA
CAAATTATCAGCCTCTATAAAACCAAATCGACGATATTTGCTAAGAAACCGGCTGGAAATGTCGTCAAGAGTCTGCTTCGCCAACTCCAGCGAGTTGTTT
CTAGATAATAAAACGTTGGCGTGAGCATCTGCACTCTCGGTAAAGTCCACCGACGTGACCGTCCACGATGCGCGGGCAAAGTGGCTTACTACGCCACGGC
CCAGCGCACCAGCACCGCCAACAACAAGCAACTTTTTGGACATTCTGAAAGTTTAGTGCTATCAAATTCAATACCATTCACCTAATCTGTAAAAATAATT
CAAACTTCAAGGTACTTGTTATCAACGAGCAACAATTGAGCATACATACTAACAATTAACAGTAATCTAGGAAAATTTCTCCGAGTGGAAGTCAAAGATA
GTTCCATTTGGGTCTGAAGAGGAGTATCGCTTGCACATGATTCCCAAGATCTCTTCAAGCGCATGGGGACCACAATAAAACACACCAACTTCCTCACCAA
CGTGGTTTGCCTTAGCCTCTGAAAAGACTTTGTCCCAGTCTGGACGGCCAAAGTGCGTGAGTTGCTTTGTGCTTAAACCTGACACAAAATCCTTGCCGGT
TTCTTCGTGCACAAACTCTTGAAACATCTTTAATTGGGAGGTGTTTTCGCTCCCCTTCAGCGTACTCAAATATTGATGCGTTTCAATTACGTTATCACGA
TCCATTTCAGCAATTTGGTTCATTGTCTCTTCAAACCAGCCAAGCGATTCCTGTCCTCGCGTGACCCAATGGAAATAtagtttttgaattttaaatgAGC
CTGGATGTCGAACGTGCTTGCAATTTTCGCATCGATTACTCTCCCATAGGTGTACCACATCCTTTAGAATCGAGGCGAAGGGGGTGACACCAATTCCCCC
ACCAACACAAATGACAGTCTTGTAACGATGATAGTCTTGAGTCGGAGCCCCAACTGGTCCATCCAAGTAAATGTCTGGATACAATACCTTGCGTTCGTGG
CAGTCCGATATCACTTTACGTAACGCCTTTGTCCAGTCACCACAAGCCCGAATGTGGACGCTTATATAGTTGTCACCCGGAGCTGACGAGATCGTGAAGG
GATGCCACTCGTGAGTCGACACGACCGGACAATTAACAAACATGTACATACCGGGGCGATAAACAAAACGTCGGGGTTTCTCCATAAACAATGCCACTAC
ACCATCCAGTTCCATGGCTTCCATGATGCGCACAGGCGCAGCAAACACCTTTGCGTACCGGTAGCGGCGTTCAAGAAGATAGATGAGAAACGGTGGCAAT
ATCCAAATGTAAGAAGAGGAGCGAGCAAGCCATGAAGCGGTACCATGCAGCGACAGAACAATCAGAAATGGACCGAAGAGCATATGCGAATACCAGAAAA
CGTTAAAATTGCCTTGACGGAACTTGGGGATTGCAGCCAGCGGAAAGGAAATACACGTAATCGTGAGCAAAATAAAACCAGTCCATACTGGAAGCGACTG
AAGCATGGTCGTGAACGGCGGTCGCTCACCATTGACGAATGCAGATACATGACGAGTGACGAATATAGAGCGCCTAATCTCGTCAGGTGTAGCGACCAGG
TACAAATTAATTTCGTTAACGATGTGGGCAACAGTATGTATGAGACCAGACGTGAGGAGGACAGATCCTGCAATTTTGTGGAAAGCAATGCTGTCGTCAA
ACGGAATGTAGCGCCACAGAATGCGACTTCGCTTCATTACTTGCGCGATCGAACGACACATTGGCAGCAATACAAAGACACAATTAACCATGATCACTTG
AGCATTCCCACGTGCTATGCGAAGACCCCAACCAATGGCGGGATCTACTTCGTACGAAAACCATTTCAACCAGAATGCGACGTTATTCAAGATGATGTAC
ACCATAAGCCACCATATGCGAAGCTTGTAGGCACTGTACCAGGCTCCAAATTTACTCTTAGGAGCGATAGGAGCGGTGTGTATGGGTTCTGCTTTGTGAA
GGTTGTACGAGTCAATGATGTAGGGAGTGAAGACCTTTTTGAACTGCTCGTACGTCATTGCCTCGTTTTGTACCTGAGCTTTCTGAAACATGAGGTTAAC
AACTGATTTAAAATCTGTGCCAACTACGTCAATCTGAGCGGCTGAAAAGTTGGACTCGAGCAACTGAACAATTTGATCCTCGACCACATAACCTGAGTTA
TCTGGATCAAGCGTTTCGAAAATAAATAGGAGCTTCTCTTCCGCATCGACTTCTAGCTCCATCACAGCATCAATGAGAATAGCATTACCGTCGATTGCAC
CAGTGCTCGTAGAGTAACCATCAAAATCGTTGCCGTCAACTTCAAATGCTTGTGTAAACGTCGCACGCTCGATGTATCCGTTTTTGCTGGGAATGCTGGT
CATAACCTCACGCAAAGCGTGCAGCTTCGCCATAGGATTATACGTTGAATCGATGGGGTTAATGCCTTGACTGTTCATGCTCATAGCCACAGAGTacttt
tgctcaaaattaCAGTCACCAAGAACTGGAACTGACATGATGTCACCGCCTAGCTGTTGCCCAAATCGAGACTTGGTAAACGACGACATATTTGACGCAC
GCACCATACTTTGGCGCACCATAGATGATCCCAGCATGGCCTCCACGTTTGGACGGCGACGACGCTGGTTGACACGGCTACTCTTGCAATTAGCGCTTGG
GCCATGCTCAACAAGATGAGTCGTGGAAGCATCCATGGTAATAAATTGACTACCTTTCATAAAACTCGAACCACCATGAAACGAGGACATCAACTGACCA
GCCATGGGAGGAGGAGGCGGTGCTGGCACGCGCTTGCGCTGACTGCCCTTTCTGCTGCCTAATTGTTGGTTATGAGAGTTGGGCGACGGCGTCGAAATGT
CAACGAAAGGCTGATGGTTTTGAGCTGGCGTAATTTTAAGATCGCTTGCTGGTGCACGTGCAGCAGCTCCGTGCATTTTACTGACACCGGTATCACCCAT
TGGAGGATGGTTCTGGCGATTCATCACTTCACCGAGAGACCTTGAGCTCTTGTGCACGTGGAGAAAGTAAACTGTCGAATTCGTCCAACTGCCTCAAAGT
ATGGCACGTAAGCTTTTGAAAAGCGCTTAGCACCTTTGAGTCCGGAAACCAGACCGATGGGATTGGCGATGAAGTTACAATCGCAAAAGGCGAAGTGACC
GTCGCAGCTGGGCATTTGCAACATAGTAATACGTAAAGTTTAGGTCCGACATCATTAAGTTTATATTGATTCCTCGTTTCTATAACCAGACTCGTGCTGA
TTTTGCAGCGGGGTAGGGGAAATCGTTTCTGGATATCGGCTGGCCGATATGTGTACAAAAA