Description :
From Genome Similarity Track
Location :
Scaffold_66:6268- 7531
Sequence
1263 bases(100 bases per row)
TTTGGCCTCTCCTCTTCTACTCCGGGAGGAGAGTGAGGATTATATGCTTCCTCCGTAGGAAGCACGGGCCACTTCAAGCGAGACTCCCCCGCGGAAAGAC
TCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAAGCAGGATCCCGGGGACAGGGGAGCGCAGGGAGACAGTAGGGGCGGGGCGC
CCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGA
GCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCG
CCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTC
ACTGTCCCCAACGTCCAAGTGGATCAGGCAGTTGAAGACTTTGACAGCCTCGACCAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCCTGGGC
ATGCCCTGGCTTGAGGAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATG
TTCCCACCTCTGTCAGAACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGA
TGATGTTTTGATGGGGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTC
ATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACATCGGATACGCTTCCTGTG
TGAGTAACACAGTGCCACACGCGAGTCGCCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGGC
CACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGCCTCAAG
TCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGCTC