Description :
From Genome Similarity Track
Location :
Scaffold_288:6267- 9973
Sequence
3706 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTGTGCGCATCACAGTTGCGCTTGTCGTCAAGCGTTGGTG
TCGCTTCCCATGCTGCGTCGTTGCCACGACCGCCGTCCCTTCGGGCGTCCGTGGATGTCCGCGGCCACTTGGGGCGCTGCGCATTGCTTCAGCGTGTGCG
CCGACGAGATGTCTCGGTGTGTGTAAGCTTGCTGCTCTTGCGTCGTCCTGTGTCGCTCGGTGGCACGAGCGCCGTCCCTCCGCCGCCTCGGTCGTCCATG
GTGTTCTTCGAGTGTTCTTTCGGAAATGTGTCTTTTGCGCTTACGTTGCGTAAGCGCAACTTTGAGAGGGGGGGTGATGTAATGGGCCCCATTTACATAA
GTAGGTAGATTGACAGTACATAAAGTAGTTAAGTCAGTACACGGCTAGCGTGTACTGACGGTCATCGTGATTGGCTGAATTGGGGGAGCCAGACCCCATT
TCAGCCAATCAGGCGTTGACTTGCATTGAGTGGCTCATATGAGACCAGGGGTAGCCGCCCTGGTCCTTACATAAAACGGAGTTGATTTTACCCAAGACTG
ACTGCTTGGTCTCATTAAATCCGAGTCTTAACTAAGCTTCCTCACCGCTACGTGTAAGCTAGTAACGGACACACACCTGTCCCGTTACACGGGGACTCCG
TTGGAGAAACTAAAGCAGGAATATGAGCGCTGCATGCGGCTCTCGACAGAGGACCTCGACTACGAGCCTGCGGTCTACATACGCGAAGGAAGTGAGTTGC
TCTCTCAGCTGCGCGACCAGTTGGTTATGCTTCCTGAGATGTATGACTTGACCCCTGAGTCCAAGATCGAGGAGGCAGGTGTTGGAGTCCCTGGGAAAAC
GACGCCCGAGATGGAAGACCAAGTGAGGCGAATTCTGGAGTATCATCGGAAGATCTTCTTGGGAGACGGCAATGGGGCTCCCCCACCTGCACGTGGAGTG
GTTTGTGACCTGGATGTAGGCGAAGCTAAACCTGTTGCGCAGCGTCCAAGGTCCATTGTGCCACACCTGTGGACCAAGGTGAGAACTTCTGAAGAAGCTT
CTGGAGAACGGGCTGATCGACGTCCCCCTGGGCATCTCCAATTGTGATCGTCCTCAAGAAGAATGGCGTTGACATCCGGATGTGCATCGACTATCGCGTG
GTGAATGGCTTCATCAAGCTCTCGCACTATCCGCTGCCGCTCATTGACGATCTTTTGATTGGCTTTGAGTCGGCGATGTGGTTTATGAGCTTGGATATGG
CGAGTGGTTTCTGGGCTATCAAGATGACCGAGAGAGCCAAGTTGATCTCTGCGTTCGTCTGTCCCTATGGGCACTACCAGTGGGTCAGGACGCGCCGTTG
ATCTACCAGGCAGTTCTCAATAACTGTCTGTGGGGATTTCTGCGGCTTTCCCCTGAGGAAGAAGCTGAGGTCGACCAGGACGTCTTGGACTTTTTGGGGT
TGAACTCTGGGGAACCCAGAGTTTCAGGTGAAAATGCACCGCGACTTTCAGTGTTGAAGGACGAGATGACTGTTTTTCAGCGTAACATCCCGGCTCCCTC
TCTGATGGGCCCTGTCCTGGGTCGAAGCTCGTATATTGACGACATCGCCCATGGTGCGCCTACTTGGGAGCGGATGTGCCAGGATCTGAACGCGCTGCTC
TTCCGACTACGTTACTGGAATATATCTGTGAGTCTTCCCAAGAGTGAATTCGGGAAGTTGTCCATTCCGTACCTCTCCCATAAGATTATTGCTGAGGGTA
TCCGGGCGACCCCTAAAGTCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGACGACACTGAAAGACGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAA
CAAGTTCATTGAAGATCTACCCATGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAGGTGAAATTCAGGAGAGACCTGTCGAGAGCCCAGGAAGCC
TTTGAAATCCTGAAGCGCAAGATTGTTTCGACTCCGTTACTCAGACATCCTGATCGTTCAATGCCCTACGTGATTATTCCCCACGCAAACCCGTGGGCAG
CATCCGCTGTGTTGGGCCAGGAGTACGACGGGATTGTGCATCCGGTTCGATTCACCGGACGCGTCCTGAATGACGCTGAGCTGCGGTATCACATTGCGGA
GAAGGAGGTGATCGCTATCCTGAGAGTCCTGGAGGTGTTTCGCACTCTGGTTGAAGGCAGCCCTAAGATCGTTGTCTACACGCGATACTCTGTGTTGAAG
TGGTTGCTGACTTTGCAGTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCACTGGAACCTGGAGATACGCATAGTTCAACGGGATAAAG
ACGGCTTGGCTGCAATTCTGGGTGCGGGTATTACCCCCAGAGAACACTTGGATGATATCGCTGAAAACTTGATCCCAGCCAAGGGGCGCGTCAAACCTCC
AGTGCCTATCAGTATGGAAATGCTGGAAGCGGATTATGAGGGGTGTATTCTGAGTTTCGATGCCGCCGCTAAGACCTCCACGCGACAAGGGAGCTGCGGC
TACATTCTGTGGCATGTCCCCGGTTGGGAAATCCTGGATGCCCAGGGATTCATCCTGGAGAACGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGA
AGGGCCTCACTCAGGCGATCGAGCGTGGAATTCAGGATATCGTTGGGGTTGGGGACTCCAGGATTGCCATCCAGCAAGCCCAGGGTCTCATCAACTGCAA
TCAGCCAAATCTCCAGAGGAAGCTGGCCGAGTATGAAGTGCTGAAGACGCAGTTCAAGTCTGTGCGGCTGGTGCATGTCAAGCGAGAATTCAACCAGGCT
GCAGACTACCTGACGTCTAAGCCCCTCGCGCTTGGTGAATTCTGGAAGGTGGAGGATGCTGAAGAACGAACACATCTGCAGTTGGTGTCCAAGATTCACG
AGAAGT