Description :
From Genome Similarity Track
Location :
Scaffold_378:6267- 9169
Transcript NameFunction/comments
g16502.t1hypothetical protein

Sequence
2902 bases(100 bases per row)
GGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGA
CACAGGAGTTGGAGACGACCGTCGAGACAGTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTT
AGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTC
GAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATATCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACACTTCGACGAGCAAG
GCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAAGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGG
TGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCATCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTT
GAAAGTCGTCACAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATTGTTC
ATGCGTGTAACAAGCTGAACGATGCGACGGTACCGGTACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAG
TACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCATAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGG
CTCGTGATGCCACAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCATCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCG
ATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAGGTCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAA
GCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTTGTCTCGTGGGGAAGAACGGCGTACGACCTGACCCAGGAAA
GGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTAC
GCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCT
TGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACT
CGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATG
AAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGC
ACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGATTACAACTCCCAGGTTGAGTACAAACCTGGAAGGTTAAATGTCGTGGCCGACGCGCT
TTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCCTTGCTGGATGTCGTGAAGGCCGCATACGCACATGATGCGGA
TGCGAAGCAATTGGTGGAGTATTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACAC
AATGGCCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACG
ATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCGCGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGT
TCGTGCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCA
ATGGACTTCGTTTTTGGTTTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTAC
CAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCG
CGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCG
TGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTC
GACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCG
GTTAATTCAAAACAACCAGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGTAGTCATGGCGACGACAAGACAG
TG