Description :
From Genome Similarity Track
Location :
Scaffold_159:6267- 26068
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.7Microtubule-associated protein
Pytiw_DAOMBR242034maker-piw_contig_159-snap-gene-0.11Eukaryotic translation initiation factor 1b
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.860S ribosomal protein L51
Pytiw_DAOMBR242034maker-piw_contig_159-snap-gene-0.12Phosphatidylinositol kinase (PIK-L4)
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.9DUF1279 domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.10Enoyl-CoA hydratase/isomerase family
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.2Ribosomal protein L15
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.3Protein phosphatase 2C
Pytiw_DAOMBR242034maker-piw_contig_159-fgenesh-gene-0.4Isoform 7 of Polycystic kidney disease protein 1-like 3

Sequence
19801 bases(100 bases per row)
CCGCCAGCACCGTGTCGGCGAGCACGATCGGACCTGAGACTAGCTTTAGTTTCTCATCCCAGAGACAGATCTTGCCGTCTTTGCCACCGGAAACGAGTAG
GCCAGATCCACTACAGTGAAGCGCATTTACCGCTGAGCTGTGGGCTTTCACGACACAGGACAGATCCCTCCCATTGAAGAGATAGAGATGTCCGTCCGTG
GTTCCCACGACCACTGACGTCGACGAGGCTTTGAGGTATTCTGCGACCAGGAAGGGCTGAAGCGTGCCTTTCTTGCCCAGCAGAGCCTTCTTGGAGCTCA
CTGCCTTGCCCTCGATCGTCCAGAACTCGATGAACTTCTGCCCACAGACGAGAAACTCGCTTGGCAAAGCTCGATTCACCGCGATGTGGAACGGAATGGC
CTTATTGCCCTTCACAAAGATCGCGAGCGTCGCCGACTTCCATCCGTCCTTCGACTCGTAGATGCCGATGCTGTGGTCGTTGTCGCCGCCGACTGAGACT
AGCGTCTCCACGGTCTGGAATGCGGCTTGAAGTACCCCGCGCTGGTGAAAACCCTGCAGGATGCATTTAGTCTCCGTCGTCACGAGGTCCCACACGATGA
GCTTTGGGAGCTTTCCAATCTCGCCACTCGCTGCGAGCGGCAACTTTGGATGCAAGCAGAGGCACAGAACGTCGTCTGTGTGGGCGAGGTGGTGGCGCTG
CTTCATCGTCCGCGTGTTCAGCACGACACACGCCGCTGCCGCTGGGTACACGATCTCCTCTGGACGACCACAGCTGTTGTTATTGCTGGAACCAACACTA
GTAGTAGTGGTGACATAGCACACGTTGTTTCTGGCCTCTTGTGCGCTGTAGCCGAAGATCCAGTCCAGTTGGATCGACACGAGTGGTGCGGCCTTCGACA
GAGTCGGCAGCTTACTCGGCGGGAAGATCGCACCTTTCCAGGGCTTCACCGCCAAGAATTCGTCTCCCGCGTCGTCGTAATTATTCCCAAGTCCAACGTC
GATACTGGGCGCTTGAGACTCGGGATTATCAGCAGAAGACGAGTCAATCTTGGCCAGCGCGCTCTTGAGCTTATGGGCTTCTTCGTTCATCTCCGATAGT
AGAGATGCGCCATGACCATTGTTGTCCAAGTCGTCACCCTCCTCAGCCTCACTGCCTCCAGTCAGGAAGTTCGCGTCAGCGAGGTCGAAGAGCTCAAACA
GGGTCTTTGCAGCCTTGTTGTGCGTACAGTACTCTCGAAACTGTTCACACGTGATCGACACCTGGTTTACCGCGCCCGTCGTCGCAGCGATTCCCGCGAT
CTCGCGGAACACGCGATCTGCGAGCGCGTCGACTTCGTCCTCACCGAAACAGTATGAGGCGTCAAACTTGTGCTTGGTCATCATGGCAGCGGACACGGGC
GCGAGGATGCGCGTGAGCCCCGCGAGCGTCGACTTGAGCGAGATCGTGAACTCGTCCAGGTCCAGCGCGCCGTCCTCCGACATGTCCCACGAGTCGAAGA
TCAGGTCGACCTTCTCGTCCATGGACGTCGCACTCACGAAAGCTAGCGCTGAGAGGAACTCGAGCGCGTCGATCGCAAACTGCTGCTGTTGGTGGCTCTG
TTGCTGACGCTGGTGCTGGCGCAGCTGCGGGTCGAGGAAGAGTTCAAACGCCTGGTCGGCGTGCTTCACTGCGCGCTGCGTCGATGCGCTCGCATCCAAG
AAGCACGCTGTGCGGCAGCAGATCTGCTGAAGTTGCGCCTTGGTGAGCGCAAACGACGTCGCGCAGTCGTAGAAGCTGCGCCAGTACGCCTCGATGGCGC
GCACGTGCAGGTTGTCGAACGGCAGGATCGCGTCCACGAGCGCAAACGCGTCGCGGTCCTTCATCGCCGCGTGCAACGTGTTGCCCATGCTGCTGCTGTC
GTACTGTGCTGTCGTACTGGTCTTTATGGGCAAGTGGCACTCAAGCAATATGTCCGCGCCTCTTCGGTGCCCTTGCTGATGAGTCGCCTGATCACATGAA
TAATGTGGCAGGTTGGTCTGTCAATAAGTGAGTCCATTAGCTACGTGGTCTTACGGCGTGTGGTAATGCGCGTGTATGTCTCTTCCTTCTCTCCGTCGCT
GCGGAAGAGGCTGCACACACCAAGCACCCGTCGTCATGGCCTGTGCGCATCCATTTTGGCGCATTGCAAGTTTCCTCTCAGTTTCACCTGTTATACTGCA
TAATTGCATCAAAGTACCGTTCAACCTCCCATCAACTGTATACTGCACTTTGTTCGTGATATGCTTTATTAGAGGTTAGACTGTACTATCGAGTTGCTTC
CCCCTCGCTCGCCACCAGCACATTTATTTGACTCCAAAAAGCCAAGCGACAAGAAGCAGCCACTCAAGGACACGAGCAAGATGGCCGACATCCAGAACTT
CACGACCTTCGGTGCGTGTGTGTGGTGCATATGTACATGTAAATCTTCGTACAAGAGTTGCTCATCCTCTCTCCCTGTGTTGCTGATTACTCTTCCCAGA
CGCGTTCGCGGACGCCAAGGACGACTCGGGCATCGGCGGCGGCAAGGTGCACATTCGCGTGCAGCAGCGTAACGGCCGCAAGTGTCTCACGACCGTGCAG
GGCCTCGCCGACGACCTCGACATCAAGCGCATCCTGAAGGCGTTCAAGAAGAACTTCAGCTGCAACGGCGCGCTCGTGAAGGACGAGGAGCTCGGCGAGA
TCATCCAGCTCTCGGGCGACCAGCGCACGAACATCCGCGAGTTCCTGATCGACCAGGAGATCTGCTCGGACTCGCAGCTGGTGCTGCACGGTTTCTAAGC
TGCGCGCGTGCAAGCCGCAGCGTGTGCGACTGTGCACGTCGTTCACATTTTGGTGCCAACAGCGATAAAGCGACGACCGTAGTTTTAAGGCGAGCGAGCG
AGAAGAGAGAGAAGAGGCATTCAACGTGATTAGACTGAAGAGATGACGCGGATACAGGAACAGCGGAGCGCGTGTCTGCTATAACGTTAGTTAGTTCTCT
CTTGGGTTGGATGAATATATTTGATGATTGTATTGGTTTCGCCTTTCACATGTGTGCTTCCATCCAAAGCTCAGTTTCTCACTTGGAAAACAAGGTGTGT
TGCGTATATTTCCAGTGCACAGAGCCGGCTACGACTTGTCTCCTTGCGTCGCAGCTCATTTACACGCGGTGGTCGATCTTGAACTCTGGGAACTCGAGAT
CTGGCTGCCAGATGCCCTGGATGGTTGGTCGGTTCGAGATCACGGGACGCTTCATGCGGGTCATCTTACGGCCGCTCGAGTTGCGCAGGCGCTCAAGCTA
CATACAGCAAATTTGTATGTCAGTGCCAGAATATGATAGAGATATACGCATTCATAACGTGCTCGTCTGTACCTGCATCAGGACAAAGTCGACTTCCTGG
TTCTTCACGTCACAGACCTTCTGGTCGTTGGTGACTGCAGAAATGCACACAAAACTCTATTAGGAAACAGCGGCATCCAGGGTTCACCATCGCCCAGCAC
TCACTGTAGTCGCCGATAAGGACTGGGTGGCGCGCTCCCTTGAGCTCCGTCGAGAACTTGACCTGGGGGTTCTCCTTCACAAAGTTCAGGAAGCGCTCAT
CGCCGAGAAGCTTTCTGTCCACACAACAAATCACAATGTAGAGACAGAGCCATCGTTAGGACCGTACAATAGCAAGGCAACAAGCATCAAATATTTCAGA
AACACTGTGGCAATTTGTTGCGGGCGGACTCGCACTGCGCGTCCACTTCGCTCACACGAGCGGCACACAAAAAGATATCGATACACAAACGACACACGAA
CGAACCTGATGTTGCGACTGCTACCGCTGTGCTGGCAGTAGCGGATGGTCACTTGCTTCAGCTGCCACACTCCCTTAGTCGCCATCGTCGCTTGCTGCTC
GTGCTGCTGCTTGCGCTGCTCTTGCTCGAAATGCGCTCCACTCCATCCACATGCGATAAATCGCATCTATGAGGATTTGCACAGTGACACCATCGTATTT
AAATGGAGGCTCACAGTATGTTGCTCAAATTATATAGATTCAGAGCTTAGGACGCAACCTGGATTTCGAGGCTCGTATTAATATAGGTTCAAACTATAGG
ACACCACGTTGATAAGGAGTTGGTTTTCAAGGTTTGCGGTCAAAAAGGAAAGCGCGCGTGATGCGGAATGCGGACGTGCGCCGCCCTCAGCCGCCCAGCG
CTGCTGCGGGCAGCGACGCCGACCCGAAGAGCGACGTCGCCGCCCTCATGAGCGTCGTGCGCGCGCACCAGCGCCAGCATGACGACCCGACCTACGACTC
TAGCACTCCCGTCGCGATCCATCGTTGCAAGACGACGCTCTCCAAGCTGCGGAAAGTGCTGCCCAAGCTCATGCGCCCGATCGCGACGGTGTCCGTCGAC
GACGCAGTGCCCATGCTGCGCGACATTTGCGAGATCGTCGAGTTGCTCCTGCGTGGCAGCGTGTGTCCGCACTCGATGATGCTCTTTGTCGAAGGGAAAG
CAACAACAGCAGCGACTATGGTGACGGGCGCTGCACACAACAAGAGGCAACAACAGCAAAGCTCTGCAAGTGGAGCGTCTGCATCTTCGTACCCGACATT
CGCGACGATGCTGTTCTATATGGTGTCGTTCTTCTCCAACTCGAACCTCCGTGACGCCCAGGGAAGCGTTCTGAGCGTGATTCTCCAGATGGCGTTGTTT
CTCCAGCAACATGACGTCTACGGCTTCCTGCACTTCTTCCGGGACACTGTTGAAGTGCTACAAGACTGCTTCCTGCTGGAAGAATCGCTCAAGAATTGCG
AATACGACCCGACGTTCCTCGGCGCAACAATCGCCTCGTACCTCGACACTGCGATCCACGTGTACCACGACGCAGACGGTCCGCTCGGCTCCACGAGCAA
CGTCACACTCTGCGGCTGTGAGCCCATAGCTGATGAAGCCAAGTTGAGAAATAGAAAGCAGCAGCTGAAGGACATGCTGCCGCCTATACACGTCGAGTCG
TACAGCAACGCCATCGCGCTACGGAGATCGATGCTGGTACTGGTGCAGCGCGTTGTTCGCCAGAGTCACACGATGGTTGCCAGTGATCCTGCGTCCAACA
AGCTGGTGCAGCTGATACAACTTTTCATGCAGAAAGACAACGCGCTACGAATTGATGATGGTGCATCCAGTCAAGTCCGAATATCACGGCAAGAAGTGGT
AGAGGTTACCCAAGCGACCTACAATCTACTCCAGACGATGCTTGAGATCGTGTCTACAACGGAGAGGAAGTATGTCCGACTGGTGATAGCGTTCTTCGAG
CACAGCGCGATCGACTTGAAGACCTCTGATCTCGCAGGCTGCACGGTATCTGCGCTGAAGGCGATTCGAAGCGGGAATACTCGGATCTCGACGTTTGCTG
CTGAGACTCTGTGGCCAGCGTTGAACGAGTGGATATCTCGGTTTTTCTTCGGACTGGGTGGTTCCCAGCGTGTCCAAGTCAGCGCAAGCACAGAGCAGCA
CCACACGATTTGGCTACACGCGGTAGAAATTGTCGTGTCGTACTTTCGCAGCTCCATGACTTCGTCACGAATCTCCATCTTCTTGGATTTGCTTGCTTGC
GCTGACATCACCACGCTGGACCCACCCAGTCAATCAGCGATCGTCGGATACGTGCACTATATCCTCTCTTCAAGGCCACTACTGCTCAAGTTCTCCCACG
CATTCGCAAAGTCTCTCCAGTCAAACAGCTTCGAGCTCGGAAAGGATGGGAATTTGGCCAGCACAAGTCGAAAGCGAACACGAGGTGGTGCACACGTGGT
GATATATCACCAGCATGCGTCGATAAATCATCCTTCCAACGGATTCCAGATGATAGAAGAAGCACGCGTGCACGATGCACTAGCCCAGTGGGTTCTCGAT
CTCGTCTTCTTTGGCAGCGAAAATGCTACAAGCGATATTGTAGCTCTGTCGCTTGCGCTACGGGTCGTCCTCCCGTTTCGAGACTGCGTTGCGAGTATGG
CACGAGCTGAGAGTTATTCGATCTCTCGCGTCTTGGTTCAGCGAATCGACTCGGTGATGAATAGCTTGGTGCTTCCAGGATCGGATCTCACTGGTGAAGG
TCTCGATTTTCTGGTTGTCATCCTCCGGCATCTTGAGGACCACGAAATCGCAAAGTACAGTGCAGCGTTCAAGAGTATTCTGTTAGTAATCGAAACCAAG
CGCTTCTTCGGTGGAGACGAAGAAATGAACGACACTCGTTCATGGAAAGATGACTCGTGGGCCCAGCTTCTGGCAGCAATGTTGCACCCTCTCAAGGTAT
CCTGCGAAGATGCTGGCGACGAAACATCCCGAAATGAGCTGTTTGGTGTCGCGTGCAAGGCGGATCTCGTGTCGAAGATATTCAAAGAGAAGAACCTGCG
TCTGCGAGCAGTCTTCCTGACGCAGTTCATGTGGTCAAGACTGAAAGCGCTGAAGATGACCCGAGAGTCAGGCTGGCGTGATTCCGTACTCTGGCAATCT
GTCTCGCGCTCGATTCTGGATGGGCGCAATCCTCAATCAGTTGCATGCGCTGCGATCGCCATGCTTCCGCTGCTCGTGCCTCTCTTGAAGCGACAATTTG
TTTCCTCGAGTGACGCCGCGATCGGCTTGCTCGAACTCCTGGTAGCGAAGATCCAAGGTGGAGCGTCGGACTTTCTGCGATCGATCATTCTCGAGACTGC
CAGCACCATTATTTGCGTCGCCGCGCAGTCTCATGGCGCTCTGTCATTAGGTGGTATGAGTCTGACTGGTGACTGGATGGAGCAGATTTGTGGCAGAGCG
CCCCCAACTTCAAGTGTCAACGGATCCAACCTCTGTGAGTGCTGGCTGAAAAGGATCAAGTCGGAAATGATCGCCATCCCCACGAAAATGGTTGGATCAC
TTGTCCCAGTTGATGCAGAAGTGCAGTCAGCCGAGGTACGCGTCAAGACGATCTGCTGGTTGACATCTATATTTCGGCACTGTGATCTCAAGGACGATAC
TAAAGAGTTCATATCCGGCTTCAAGATGATTCTTGCGAGGAGTCTGGATGATCTACCAACCTGCCAGACGACCTCGGATCTGTTGGGGGATCTAATCGCC
CATCCGCCGTTTGCCCAAGTGCTTCTCTCCCCAGCGAAGGCAGACGACAGCGACTTCGTTATGCGAAGGCTGGATGCAGTGCTGTCGAAGGCTGAAGAAA
TCTTCGACGTACAAGCGCTGCTTGCTGTGATGCCTCTGCTTGGGTCACTTGGTTTAGCATGCGACCCTGGTGCTACGGAGCACATGGAAGTCTTGGTTTG
GGTCATGCTCCGTTTGGCGTCCATTTGGAGCAAAGCGCAAGTCAACAAAGCGCCAGCATGTGCAGCGGCTGCGTACGACCAGATTCACCGGATCACAACG
CACCATCAACTGTCGTGGCGGAAATTGTGCGTCGAGAATCCTGAGCACTGCTATTTCCCACTGGTCGACGAGCTCATCGCATCGCAGACACTGCGCCTGT
TCATTCGAACATTCATGGGACTGACGATGGATACGACCGAGTTCCTGTCGGCTAGTGCCCCATATGTTCTCCCAAGATATGTCGTTGATCAAAATGACGA
GATGCTGCAGACTTTCTTGGCGGAGCTCAATGGCGCTGAAGAAGAGAACTCGGGTGGATACGAGAACGGCTCAGAAGGCGATGATTTTCGGAAGCAAACC
ACCATCACCGACTTGATGCGGCAACATATCGAGTTTGTGCTGAAGGAGCTCATCATGCATCAAGTTGAAGCCGATAATGGCAGCAATCGACTCGCCGAGT
TGGAGTTCTTGTTCAAGTTCTTGCCCGAGAACTCGACCGTTCGCGACGTGATCTCGCATTCGCCGCTTCGTTTGTTGAATCTTGTCGCATGGGAGCTGAG
CGGCCCGCGATTCGACGCGGCAACGAAAGCGTTTCGACTGATATCGCCGTACCTCGATCGAGAGCGAGGAGCTGATCCTAATTCTGGTGGCACCGGCAGT
GTCGGACCAGATGACTTGATGATGCCTCGTCGGTACTTTTTGGCGCTGATGACCGAGCTCGGAAACAAAATTGGCGAGAAGAGTGCAAAAGCAAGTTCGA
CCGCAGAGAAGATCAGAGCGATCACAAGTATCAATCGACTCTTTGAGTTGTACAAAAGCTCGCCCTCCCACGACTCGGAGGAGAGTGCGAGCAACAGCGG
GGTCATGGATCCATTTGTGCCGAAGGTGATGGCGACGTTGAAGATTGGTCTCATCGAGGGAGAGCTCCAAGAACATGCTATGAAAGCATGGGCGACTTTT
CTGCACATGCTCTCGATCAAGGCCCTTGAGACCAACTTCTGCTCGATCGTCGTGAGTCTCCTCCCGTGCATCGGATACGACCCAGGGATGATTTTGCAAG
AAGGTGTGCAAGTGGCATCGAGCCCGTTCAAGCTTTGCTGGAACGTCGACGTGCTTCAGAAAGAACAATCTTCTGAACCCCAAAGCTCAGCAAGCGAAGC
TCCCAAGAGCAAATCTGCCGCCGCCTCCATCGCGCTGGGAGTTTTGAAGTATTTGTTTATATACAAGAAGAACGAGCTCAAACAGGCGTTTCCTCGCATT
CCGCTGCTTCCCTCAATCACCGAGCTCGATGAGATCTACATTGCGCTGGAAGAGGAAGTCGGGGATCCTGCGGCGAAACGCATCGACGAGTACCTGGTGA
ATTTGGCGACGTACATCAACCACTGGGATATGTCAGTCCGCGAAATGGCTCTGGCGCAGCTCTTTCGGTGCTTGGTTCTCCGCGGAAGAGAGCTGACTAC
GCTCATGGAGAACGAAGGCGATCTCTTTGTGGACAGAGCCGTCGTCGACATCATACTGTCCATCTTGCAGCTTACAAGAACGGAAAGTCAAGAAAACGTA
AAGATGCTATGCGCAAGGTGTCTCGGAGCTCTTGGAGCGATTGATTCAGCGAGGATGCCGCCCACCATGTTTTACGAGTCCAGAGTAGCCCAGAGCGGAA
TTGTTGCGAAAGACAAGTCGGAAATGCGAGTCGAGTACTCTACTAAGGACTTGGCGTGCGTCCTCATCGAGACGTGGCTGGTGAAAGAGCTTCGCGCCGC
GCCTGAAAATACCGATTCGGTCGCATTCGCCATCCAAGAGCTGCTGAAGTTTCTCGCTGAGCTGACTGCTGATCCCCAGCATAGTGGACAAAATCTGCCG
AATGGATCTGGAACGAACCAGAAGCCAAAGCATGCTGCCATCCCGATCATGCCAGAGTGGATGAAGCGTCGATTTGAGAGAAAAGAGGTGCTGCAGTTCG
TCGAGCCGTACTGGTCTACGAACTACAGTCTTGTCAACAATCGATCGCAGCAGAACAAGAACTCCGGTGGAGGTAGGAGACAATCCGGAGACACAGACCG
AGGTCTCCATCCTGCTCTGGACGACATTACCTACTACGAGAAGCATGGCACATCGTACGAAGAGTGGCTGTTGCTGTGGTGCAAACGACTTATTCACCTC
TCGCAACCACCCGAGCGGAAGATTTTCTGGGCGCTTCGAACTGTGCTGCCCACTTCCGCTCAGATCGCTCGCTTCTTGCTCCCGTACCTGATACAGAATG
TGCTGCGCTCGGGGAAATCTGAAGTGTACGGAGAGATCAAGCGCGAGGTAATGGCTGTGCTCAATGACCAAGACCGAGGGATTATGGTCGACGAGTACAT
GGTGCCTCCTTCCGAAGTTAATGGGTCGTCGTCCGCTCGAGGGATTAACGCTCCGGATGAAGAGAAATTACTCGGCGAAGACTCCAGTCGTCATCACCAA
TGCTCGCAAACCATCTTCTCAACGATCGAAGAGCTGACCGAGTGGGTGTGGAACAGCGAAAAGAAACGCTTGGCGCTCAGCAGCAGCGCAAGTCGTCAAA
GCGCTGGGTCTGCGCGGTCTGTCGATATCCCGTCCGAGTTGGAGGACCAAGAGAAGGAAATTCTCGAAGAGTTCCTGAAGGATATCCCAAGTCAGTCACT
CTCAAATGCGGCATTTGGCATCGAGGCGTACGCGAGAGCGATCCAGTACTTCGAAGTCTATCTGCGCCAGCAAGATTACAAACCTCCAGCTGGGAAGGAC
TCGAATCACGCTTACTCTGTGTGGCCAGTACACCTCGCGTTGGTTTCGAAGAACGCATTCTACCTGCAGCAGCTGTACAAGAGTGTCGACGAGCCTGATG
CTCTCATTGGACTTGCAACTTTGCGTCGACTGTACGAAGCGCAACGTCACAATGACGGGGAGAGTGAATCGCGCATGGGAGATCAAGAAGATGGTCTGAA
TCTGACTGATCTGATGCACCAGGTTGTCGACCACGAGCAGCTCGCTCAATGGGAAGACGCGCTGGCGTGCTACGAGCAGGCCATCCAGGAGATTCAAACA
GTGCTGTCAACTCGAGCATTTTTCTCCGCCGGATCGCAGTTTCGCAGGCAAAGGATGCAGCTTCCTCGTGGTTTACTCACTGATCCGCAGACAGACCCGG
AGCTTGTGAAGCCAGAATTGTACTCTGGAATGATCGGTTGCCTGATCCAACTGGGCCGCCTCGAGAGCGCCCTGCAGCATATTAACGGTATCGTCACACA
AGAACCTGAGTACATGGGAACACTCTTCCCTTATGCATTGGAGTGCACTTGGCGACTTTCTCGCTGGGAGCTTCTGACCGACTTGCTTTCATCGGAGAAG
AAGAATGCGCTGCTGATATCGACGAGTTCAGGCGCTGGCTCGAATGTCGGACACAGTGGCGTTGGATCGCGATTGCGGGGAATCGATGTGTCTCAGCTCA
AGCTCATCCGCGTGCTTCACAGTCTGCACAACGGCGACCTCGACTCGTTTCAGAAAAATCTGAAGGATGCCCGAATCGAGGTCATGGGACCGCTGGCAGC
TGCTTCAGCGGAGTCATATCAGCGCGCGTACCCGCTTCTCCACAAGCTACACTTTTTGCACGAAGCTGAACAAGGGTTTATTTTTTTGCAAACAGCAAAG
GAGCTGTCCGACGTCGACGATAAGACTGATCGATGGCGAAATCAAGCTCCGTGGGAAGCCCGGTACGACTCGATGCCGACATCACTCAAGTTTCGCGACC
CGATTCTTGCATTGCGACGTGTGCTGCTTCAGGAAGCCAACCTCCGGAATGAGGTCTCGCATTATTGGCTACTGCAAGCCAAGCTCGCCCGCAAGGAGGG
TTACACTCGAACTGCGTCGAGTGCAGTCATGCACGCAGAGGCCCTCGATAACCAGTACGCCTTGCTGGAGAAGGCGAAGCTGATGGTGAGTCAAGATCGG
ATGTACGAAGCGCTGCAGCTGCTCGAGCCAGTCGGAATTGATGCTGCGAAGCTCGACTTCAATGTCGAAGACCCGCACTTTTGCGCCAAGAACCTATTGC
TTGCTACGAATTGGATGCAAGCGTCTGGTCAGCGACAAGGGAAAAAGGTGATCGAGCGGTACCAGGCTGTCATCCAGTTTGACCCAAAGTGGGAGAAAGG
ATACTTCTTTCTGGCCAAGTACTACGAGTATCTGCTCAGCGTGAGCCATCCAGAAGCGAACGGCTCGATGGGGGAAGAGGGAGGCTCAATCCTTCTGGAC
AAAACCTTCCACACGCATCTGATCAACCTGATGAAGAACTATGTTCTTGCGTTGCAGCACGGGACGAAATTCGTCTTCCAGTCGCTTCCTCGGCTTCTCA
CGTTGTGGTTTGAGTATGGCGAACTGCTTTACGCCAACACCTCGGGCGCAAAGGCGAGCAAGGCCAATAAGACTCTCCGACTTCCTGAGTTCGGGCTCAG
TCAGTCAAGCTCGGAGCAGAACATCCTGGCAGATATCACCGACGTCATTCACGGTGCAGCAGAGAAACTACCGGCGTACGAATGGCTTGTTTGTTTCCCG
CAGGTGACATCTCGAATCTGTCATCCAAATCCAATTGTGGTCGACGGAGTGAAGAAGATCATGGTGAAAGTGCTTGGAGCTTATCCGACGCAGGCGATGT
GGCCGCTTCTCGGACTTTCTCGCTCGCTCAATTCTCAGCGTCGGAATCGAGCCCGTGACATCATCGCGAACATTCAGCGCCATTTCGTCTCTACGGGCCA
GCAGGAGATCGCGAATAGCTTCTCAGAGGGGATGCGCCTCGTCGAAGAGCTCATTAGCCTCGCGGGCCACGACCCAGCCAACCAGCGGAAGATCCATATT
AGACTGAGTCGGATTCGAAGCAAAATCCTCGTTCCTGTGCAGACAGCGCTGACGACCGTGTTGCCGGCTTCTGGCTTAGCACCACAGGATATAGATCATA
CCGCATTTTCGCCGCATGGGCAGATCCACATCAAGGCGTTCAGTGACAAAGCCGACGTGATGATGACCAAGGAAAAGCCGAAGAAGATCGAGATTCTGGG
GAGCGATGGCCGACTATACCCGTTCCTTTGCAAACGCGAGAAGACGGGCGACCTGCGCAAAGACGCCCGGATGATGGAGTTCAACAACATGATCAACAAA
CTGCTGCAGAAGGACGGCGAAGGGCGCAAGCGCAAGTTGCGGCTGCGTACGTACGCGGTCGTGTGCCTGAACGAGGAGAGCGGATTGATGGAGTGGGTGC
GCAACACGAAGGCAATGCGGCAGCTGATCGGCCAGATCCACAAGACGGAGCGTGGGTTCATCCAACCAGTGCGCCTGACGCACGACATCAAGGAGCGATT
CCTCGGGATGCAGAAGAATTATGCAGACAACCTCCCCAAGATGGCGGCCTACTATCGCCGCAAGATCCTGTCGCAACCAGTGTTCACGCCGCGCTTCCAC
CAGTGGTTCTACAATAACTTCGCCGACCCGACAGCGTGGTTCGAGTCGCGCATGACGTTCTCGCGGTCTGCCGCCGTCTGGTCCATGGTTGGCCACATCA
TCGGGTTGGGCGATCGCCACGGCGAGAACATCCTGATCGACTGCACAAACGGAGAGTGCGTCCACGTGGACTTTGACTGCCTCTTCGACAAGGGCCTGAA
GCTCGCCAAGCCCGAGATCGTGCCATTCCGGCTCACGCCAAATATAATCGACGCGTTCGGCATCACGGGCTACGAGGGCGTCTTCAGACGCGTGTGCGAG
GTCACGATGCACCTGCTTCGCGAGAACAAGGAGACGCTGCGCAGCGTGCTCGAGTCGTTCATCCACGATCCGCTGGTGGAGTGGGGGCGCAAGGGCAAAG
CTGCGCAGATAGCACCAGGCGCGTCCTCGGCCACGCGGAGCATCGCGGAGATCTCGACCGACCGCAGCAAGGAGGAGACGCGCATCCTCCTTAAGACCAT
CGATGACCGACTGCGCGGCATCTACAACCTGGGCGACGCCATCCGGCCGCTTGTGTCGGTGTCGCATCGCAGCATCCTGCCCGAGAACGAGACGCTACCG
CTCTCCGTGCAGGGCCAGGTGGACAAGCTCATCCACGAGGCCACGGCCCATGAGAACCTCGCGCAGATGTATATCGGCTGGATGCCATTCCTCTAGGTAG
GCGCCATGAGTAAGTACCAACATAACACTTGCCTTGGAAAAGCGAATGCATTGTTTTTTGTTTGTTTGTGGCTGTGACAGGCGATGAAGAGCTACAAGGT
GGGGCTCTAACATGGGAAACGAGCAATTCGACTCCAACCGACGGACTGACTAATCGCTTCTACGCCTTGACCTCCGGTGCCTTGTCCTTGGAGAACATGC
GCTTGATCGCTGGGATAGTGGCGAGTGCGATCGGGAAGCGCAGCGGCTCGAGACACTCGTTGAGCACCGCGGCGAGCGCGATGTTGCTGTATGTTGGGTT
GAGCGTGTTGACGTCGATGAAGCGGTCGAGCCCCACGTCCATGATGAACTTGATCGCGTCGGTGCCGGCGATGAGTCCCGTGTCAAAGGCCACGAAGAGC
GCGGCGCCCGTGCCCACGTACAGCGTGGTCCACCACACGACGAACGGCAGGCCGAACTGCGAGATGACGGTCATGAACTTGCCCGGCTTGTTCTTGACCT
TCTCCTCAAGCTCAGCCACATGCTTGCGTAGCGCTGCGTTCTCCTCGAGCAGCTCCTCAAAAGTCTTCTTTGGTGATGGCGCGTTGTTGTAGTCCTTGCT
GTCTGGGAAGGTCGCGAACGCGTGGGTCTGCATGGCCTGCAGGAACGCGCGCGACGAGGACGTCGACTGCTTGGAAAGCGACTGACGCAGCACTGGGAGC
GCAGAGGCGGAGGACTTGAAGGCGCTGCTCTTCATGGCGAACGCGCCGCGCGTGACGGTGGAGCGGAGCATGGCGATGGCGAGCGACGATCTCTTTCGTG
CAAGCGAAATGGGAACCTGGGACTTGTGTCTGATGTTTTTGGTGGGCTGTCAATCAGGCACTTTTGCTCGGAAAAAGCGATGCCACAGCTGAATTCGTCC
AATCAAACAGCATAAATAGAGCGTAAACAACGTATTTTCAGCCAATCATCACGGCGTATTTTGGGTCGTTTTTTGCCGTATTTATTTGTCGAAAATGGAG
CTCTGCCGCATCGTCTCGGAAGCTCCACGATGAGGAGTACTCTTTATCTCCGCCAACCCAAAGCTACTCACCCTTGTACGTCGGCTTGCGCTTCTCCCGG
AACGCCTGGAGCCCTTCCATGCGGTCCTTGGTCGGGATCACCTGCGCGTAGCACGCGCGCTCGATGGCCATGCCTGTGGCCTGGTCGACCTCGAGGCCCT
TGGTGATCGCCTCCTTCGCCATGCGCACACCAATGGGGCCATTGGGGAGGATCTCACGCGCGAGCTCGAGCGCCTTTGCCAGCGCCGCGTTCTCGTCCAC
GGCGTAGTCCACGAGGCCGATCTTCTCGGCCGCGTCCGCACCAATGCGGCGGCTCGTGTAGATGAGCTCCTTGGCCTTGGAGAGCCCAATCAAGCGGGGC
AGACGCTGGGTGCCGCCGGCGCCTGGGATGATCGCAAGGGACGTCTCGGGGCAGCCGAGCAGCGCCTTGGCGCCGGCGATGCGGAAGTCGCAGGAGAGTG
CCATCTCCAGGCCGCCGCCCAGAGCTGCGCCCTCAATCGCAGCGATCGTTGGCATCGGAAGTTGCTCAAGCTCCGTGAAGCCACTTCGCAGACCAAAGAC
CGTCGCAGCAGCCTGAATGATACGTAGGATAGAGCGTTGTGAGCCATGTGTCGGTTAATCAGCAGCTACTATAGACTATTCGTACCTCTTCTGGGGTCAT
CTTGATCCGCTCCTTCAAGTCCGCACCGGCACAGAACACTACAGAAGGCACAACCATAAAAGTTAATCAGTCCATGGACGTCACACTGGAAGATGAGCAA
CGACACCTTTCTTTACCTTTCGGTACGGTGCTCTGCAGAACGACGACGCGCACGCTCGTGTCGAAGCGGATGGAGTCCATCGCCTGGCGGAACTCGACCA
TCATCTGCTCGCCGAGCGCGTTGCGCGCCTCGGGGCGGCTCATCGTGAAGAGCGCGACGCCGGCGTGCTCGCCGTCGAGCAGCTCCACTTTGAACTGCGC
CACCGTCGGGTCCGAGACGACGCTGAGTGCGCGGCGACCACTGAGCAGCGCACTGCGGGTGGTGATGGCAGGCGCAGAGGCGCGTGTGAAGAAGCGCATG
GTCATCATTGCTGCAGCCACAGACACGAGCTGTTCACTCGGGTGCCAATCTGGAAATGGGCTCGTGATATGAAGCGCCAAGGTGTCAACTCTATGAAAGA
CGACCCGGAGTCGTACTTTAGTGAGCTCACACAGTAGATAACTTCAAGGTTCAGAGCGAACTGTAGATGCTCGGTAAAGTGCGATTACACAAGGTTGCTC
GAGTGAGAAGGTTGTACGAATGTATACTAACACCTCGGAGAATGAATGGCTGGCTGGCAACAGGGGAGCTGGTGGTTTTGGATGATGGCGATAAGCGCAG
TGCTGGCCCATTAAGCCTTTTAAGACCAAGACCGGAATCATGGGTGCCTACAAGTACTTGGAAGAGCTCTGGAAGCGAAAGCAGTCGGATGTGCTCCGCT
TCCTGCTCCGCGTGCGCGCGTGGGAGTACCGCCAGCTGCCGGTGATCCACCGCGTGAACGGCCCAACGCGCGTCGACAAGGCGCGTCGCCTCGGCTACAA
GGCCAAGCAGGGCTACGTCGTCGCCCGCGTCGCCGTGCGTCGCGGTGGCCGCAAGCGCCCGAACTCCAAGGGTATCGTTTACGGAAAGCCCAAGCACCAC
GGTATCAACCAGCTCAAGTTCGAGCGCAACCTGCGCTCGGTCGCCGAGGAGCGTGCCGGCAACAAGTTCAGCAACCTGCGCGTGCTCAACTCGTACTGGA
TCAACCAGGACGCCACGTACAAGTACTTCGAGATCATCATGGTCGACTACTCGCACAAGACGATCCGTCGCGACCCGCGCATCAACTGGATCGCCAACGC
CGTGCACAAGGGCCGCCAGCAGCGTGGCCTCACGTCGGCCGGCCGCCAGGGCCGTGGCCTCCGAAAGCGCGGCCACCGCGCCAACAAGATCCAGGGCTCG
TCGCACCGCCAGAACTGGAAGCGTCGCAACACCCTGTCGCTTCGCCGCTACCGTTAGACGGCGCGCTAGCGTCGTCGTGGCCTTGGCTCGACACTGGCTT
ACTTGCTGGGACGCGCACGTGGGCGCGCTGCTTTCTTCTTCGCCTTGGCGGTTGGTGGTGACGCAGTAGCTCTCTCTCGATCTCGCTGTTAGTGTATTCG
AATAGCGATAACGAGTGGGTTCTCGATAATCATAAAGCAGCTCTCTTTCTTGTCGTGCTCTCATGACAACTCACACAAACCAACCTTCGTCTTCATCGTC
ATTGTTATGCATAGCTTGTGGACAATTTGTGAGGTTTTTATAGTAAGTCAGATTGTAAACCTGACCTTGTCTGGTAGTCTGACTCACTTCTCAAATAGCA
AATTGCAGGTACGAGACTCGTTGAGAGGAAAGCAAGAGAATGTGCGGGTTGCTGCAGCGCACAACGGCGAGTGGTCATGAGACGCAAGTCTGTTGTGTAC
ACATGGCATATGATTAACGTGCAGCGCCGGGTTTCTATCTCTAGCTGTGTTTGCCCACAGGAGAGACAGAGCGAGAGATGGCGGGCTTCAACTGCTGCCG
CTGCGTGAGCGTTTACGAGCAAATGGTACGGCCTGCAAGAGCGACTGATGGCACTCCACTTGCATCGGTGTCTTACATGTGAATGTGCACGTGTATGCTG
CAGAACCCAGAGAACCGCAAGACCATGGAGGACACGGCGCGCGTGGTCGACAGCTTCCTGCTCAACCCGCAGAACGGCTTCTTCGCCGTCTACGACGGCC
ACGGAGGTACCGCATTGCATTGCACTATACGCTCCACTACTCAGACGTACAGCTCACACGCGCACATATTTTCGCTATTATATGGCGAACTCGTTATTAG
GACGTGACGTGTCCGTGTATCTGCAGAGCACGCTTCACGAGAACCTTGCGACTGAGCTCCAGTTGCCAGCCGATGGCGTCACGATCGAGCAGCGGATAGA
ACGGTGCGCATGGCTAAATTAGCAATGTTGGGTCGCTGACACACTGCCGTGTGTCCGCAATCCCGAAGCACTAATCATGATCGGGTCGTTTGTGTGCTGC
AGCGCGTTCGTGATCACGGACCTCGAGTGCTGCGCTGCGTTCCCTGGCTCCATGGGCTCCACCGCTGCCACGGCACTGTTGCTGGGGAGTGATGATGGGA
CCAGGCAGCGCACGCTGTACACGTCCAACGTCGGCGACAGGTGAGCTCTTCGCGTCTAGATGGCTGCTTCCTGTTTATTATGTTGGCTCATGATGCGAAT
GCTATTATCTGCCAGTCGTGCGGTTATCTGCCAGAATGGCAAAGCGATTCGCCTCACAACGGTAAGTTTATCAACTAGTTCGAAGTATGATTTACTCAAG
ATACCAACCAACTGACTTTAGAGATCTTAACATTGTTGTTGCGTGTTCTTATACATTTCTTGTAGGACCACAAGGCCGACGACCCAGACGAGATGGCGTG
TATCACTGAGCGCGGAGGGTTTGTGATCCACCACCGCGTCTCGGGCGTCTTGGCCGTGTCCAGGTGCGTTCTTTGGATTGAGCTTTGTGAGATCTTGTCT
GTATGCTTTGGAAATTGGTTGGTAACTGTGGTGGTCTTATAAACGCAGGAGCTTTGGTGACCGCGACCTCAAGCAGTTTGTGCTCGGAAAGCCCACCACC
ATGGCCACAAGGTACGTCGATAGCCCAAGACTAAGGCTATGTCTGTGCTATGCGAGCTTGTAGGTTGTATGCTGACCCTGGGATGGTATTCGTAACTTGA
AATATGTGATTTTTAGACTGGAGCCTGCGCAGGACTTTCCGTTCCTGATCCTCGCTTGCGACGGCGTGTGGGACGAGCTAAGCGACCAGGAGGCCGTGGA
CTTGGTCGCCAAGTTGCCTGTGAGCGAGCACGCGAACGCCGCGCGCGTGCTCGTGGACGAAGCGCTCGCGCGCCACAGCTGCGACAACATCACGGCGCTT
GTCGTGTTCTTTTAAAGAGTTCTTATTGATCTTTTGATCCTAGAGCGACCAGTGTTGAGGATGCGAGGCGGTGACATGACAGCGTCGTCTGGGTGGCCAG
CCTCAATGGGATTCTTGACGAAGATTGGTCGATATGGACGACCAGCCTGGAATGGAAACTGGGGTTGTGGAGAAGACTAGAGTTCCATTGGCCGCATACT
CACCTCGACTCTTCGGGTATGTGTTCCTGCTGCTCACTTCTCAGTCTGTCCCTGGGTTTGATCGCATACCAGGATAGGGTGTTCTGGTCATCGGTCTCAG
ATTTTGTTTTCAAAGTAAGTTCAACGCACCCACTAATGCGATTTGTACAGTGACCTTGAGACCAACCTACAGCTGCTGCTTGTTACCCGCAAAAATTGGG
AGAACATTCCTCTCCGCCAGAGCTTCTCCTCTCCCCCATACGAAGACAGTAGTGTAGCAGAGAACTGCGTTCGAGCTCTCCGCATGGCTGCAACGTCGCA
CCTTTTAATCCGACTTCATCTGCCAATCCCACACAGGGGGTGCACTGTACTACTATGCCATACACCCATGGTTTCTTAAAGTGTCACATGAAAGACATGC
TCAATATTCTATTGACAGTTACATATCAACAGGGGTTGTTTATTCCGGTGAGAGTGCTTAATCCCACAATTACGCACATGTATCCATGTAGAAACGCCGA
AAGGTCATCATTGTCAGTGACATCCGGACCCGGATGAGCAGATGGCTGCCTGTCCGTCTGATTGCCAACAAGCAGTTCACTCCCATACACTCTCCTGTTG
TTTTCCATGTCGGCCTCCCACACACCAGCTGCTTGGATCGCCAGCGTCGCATGATTTCCGTCCCCAGTGTCTTTACGCTGCGTCGGCGGCCCATACCGAG
TGTCTGACCGCGCCGCCTACCTCTACAAACACCTCTGAACTCTATGGCCCCCTCTCCCCTCTCTCTTGGCCCATGGCCGCATCCGCATCCTCACTTTCAC
ATTTTCTGACGACACTCACGAGTCCCAACGGAAAGGCTCGTACTCTACTGCCAACCAACCCCAGCAGCCCAGCAGCTACGTATCCCAAGTCTTAGCAGCT
ACAGCTAGCTAACCATGGTGTTCGCCTGTGTCAAGAAGATCTCCATCGCGCTCGCGGTCCTCGCGACGCTCACGGCACAAAGCGCGGTGGCCACCTTTGG
CAACGGCAATGGCTACGGTGGTGTTCCGAGCCAGGTCGGCTTTGGCCATGGACTCCCGGCGGCGGCCAGCAACAATAACCACAACAATGGCAACAACAAT
G