Description :
From Genome Similarity Track
Location :
Scaffold_8:626539- 633406
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05821hypothetical protein

Sequence
6867 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTATTTACTGTGTATTAGACTACCAGATACAAACAATAGGATAACACCTTATTGTTT
GCACTAATACCAATCTCACTTTTCCTTTTCCCTTTCGTTTCAAACCTTCTCCCACGTGTCCTTCTTCAAGTGCAAGAGTGCCTTTCAACAAAACCTTAAC
ATCGAGTTGGCACCTATAAACTGAACCCGCGTCATTGCCTGATTAGACTAACGCAAGATATTATAAATATATTCTGATGGCAAAATATATCATTGTTACT
AAAAAGAAAGAAAACAATCCTGCGATTACTCAACACAAATCCCGTGCTAGGACTTCGTGTAGCTATGGCATAGCTACACGTTTCGGCTGTTATTCAGCAG
CACTACCAAGCAACAGGACATCACAAGCTACAGGGGATGACAGACACGTTGGCGAGTATCTACGCAAGGTTTCTCATGGCTATTTTCTTCCAGCCGATCG
GTGAACTCATTTCCAATTGAAACATGTGGATCTTTGCCTTTGCTAGCGATTTTTCTACGCACAACGAATGTTCTTTCATTGATCAACGTCTCCGGCTCGC
AATCGACGGTGTTCTAGTTATCATACCCTAGGTTGCAATTCCTGTCTTCGAACGCCATTCTGCAACAGTACAAACTAATCTGATTGTATCTACACTTGAT
GCTCTTTATGCCCAATGGAGAGACAAGATGGTTGGAGTTGCCTCCGACGGTGAGAGCACTATGACAGGTAGTCGTGCAGGTGTAGTCACTTTGCTGGTAA
AGGAGGCTACTCATCCTATACTACGCGTCTGGTGTGCGGCACATCAAATGAATCTTGTTATGAAAGCAGCATTTGCAATTGTTGGTGGCGGAAACTTCAT
GAATGAGACGAAGGATTTAATCGTTCATCTTCGCAGACAATAACTATTGATTGCGGAAATGGGTACTGCAGCAAAAATAAATTGACACTACATGGGCAAC
TCACTGGAATCGATCCTAAAAATCCTGTTCAATTACAGTCTCATTTTCAAGAACGTACGTCTGCCTTACCGCCTTCGATATCGTGGGTGAATGCTGGTGT
TGTCTACGGAATCACATCTGTGGCTAATTTGAGTTTTTACCAAAATCCAAGCGAAAGATACGCTTCTACCGCAGCAAATGAAAGAAATAAAAGCTCTAGT
GGCTGGATTGCGAAGTCTTTTGTCAATCCAACCACGAATCGAGAAAACACTCTCACATCGCGCAAATGACACAGTTACGGAAAAGTTTTGGCTCAAGGAG
CAAGACCTCATCAATTATGTGCGAGATCAAAGAAAACGCACCTGGACTCTCTAGGACATGAAGAGAGGCAATCGACTCTTCAACAGCTAGGCCAATTTGT
GGTTTCTGTTATTGAAGGAATGGAGCTTGTACAAGCCGATAGAGGTAATAAAAACAAGCCAGCGACAAAGCTCGCACCACCAGTGATGCCATCAGAGCTT
GTTTTGGTCACTCCACGGGATTTTGGTGAGAACGTGTTGGGACCTCGGCGTGATCAACTGATGAAATGTTGGAATCTCGATCAAGTTGAAGCTGCAGAGC
GCGAACATAGAGATGTATTCCTAGCAAACGCGCTAAATGATTCAATCAGGTCAGTGTTGGACAAGCAGGACTTCAAAACGAAATTTAATGAAGGGTGGGA
CGCACTGGAGGAAGCTGCAAAACCAAAAACGTTTAAGCATCTCCGTCAGTTTGGATGTGGTTTAGCAACAATATTTGCTAACACGGCATCGATAGAGTCT
GACTTCTCCATATTAAAGTGGAAATTGAACGACCGTCGAGCCGCTATGACTTCACTGGCCTTTGAAGGAATATTCCAGGCGTAGCAGTTTGACGAACTCT
ACAATCTAAAGAAGCGAAAGTAATCAAGGTAGCTATATATCGACATAGTGCCGGAAATAAGATTCTGGATGTGCCGGAACTAAGCTAATGCGACACAACT
CGGCATATGCCGATTTTAAGGAGGTCTGAACGATGGTCGAATGGACACAGCCACACGGTACGTCACGTTGTCGTAGCGAGCAGAAACAATCGGTAAATTT
GTTAATGTATTTGTCGCGTTGTTGTGGCGAGCAGAAAACAATCAATCGGTAAATATGTTGATGTATTTATTTCGATCCCTGCAGTTGTCCAGTACGCCAA
CCAAAGCTCCTATCTCATACTTGTATTCTCAATAAAGGTTTATATGAGTTGATAAGTTTGGAGCCATTAACTTGGAAGGACTCGCACAACTCCATTTCAT
TCTGCGATTCCCTCGGCAGCCGGCAAGTCTCCTCCCTCTCAAGAACCGACAGCAAACATGCGTCTTACCAACATCTTCTCTGTGACTATTGTGGCCATTC
TCCATTCCGGCAGCACCGCTCTCCCTTTGATCACGGACCCGAAGACTTTGGTCGCTAGCGATGCCTCGACTGATGTTGTCGCTCTTCTGCAAACCAATGG
AGGGCGGCTGTTGCGACGTGTTGGATATGATGATGAAAGTGAGATCGAGGAAGAGAGAGGCTTCGGGGAGGTGAAAAAGGCGGCGAGTAAACTGAACCCA
GTTAAAGCTGCGAAAAAGACCGCCAAGTTAAAATAGTCTATCAAGGAAGCGGCCGAACACGCAGCGTGGCTTGAGAAAATGCGGGAAACGATTGGGAAGG
ATTAAGAGCTCGGCCATCATTAATGGCACGCAAAGCCCTGCCGTGAGTGTGCTCTACGAGAAAATATCTTCCCTTACGAGGATTTGCTCGGTGGTTAAGT
TACCCCTAGCAACATCTAATGTGGTAGTAACTATAACCAATCCTGGCTAATAATACGAGTTACGATCGACCATTACATGAACTACTGACTCAAGTCTCCA
ATCTCATCAGACCCTTTCTTTTATTTTCACTGCCTCCGCTAAGCAAATAACGCCCTATGATGTGCTTTCACAATGTTGGTTAATTTGCATATCCTCCCAA
ACACGAATAAATCGTTTTCACAGGATTTTGCATCGTTTGTTTTTTCCCGTCGAACTGGTCACTACTCAAGATTCTCCCCTCCAGCTCAAGAGATTATGAC
TAAGATTCATTAGAAATGGGTGCGACAGAGTATAGCAAATCAAGGCAGTATCACGCAACAAACCAACTAGGAAGTGAAGAAGAATTCTAACCGGAGGACG
GAAATCGGGAGGGGGAATAGATACGATGCGTACGCCTGGAGATGCTGCGTCAGGCAAAAATGTGCAGACTGTTGATATACGATCCTGGGTGCTAATGTAG
ACGCAGGTTGTTTAAAAGTAGTATTAGATTGTGCTGCTGTAGGGAAGAAACACTGGAGCGTGAAGATCGATTTTGATGGCGGAACTATGCAACGATTTCG
CTTATCTTGCGCCTCGCATAAAGTATGGCAAGCTGCATTGTCATTTGCTTAAGTCAGTGATGTCCTGCTGAAATCTACTAGTCCAGCAAGAGAATACTAC
TGTGTTGCGCTGCGTTATGAAGCGGGGATGGGCCTCAAGATGGCTCCCATACCTCGTAAGGGAAGTTAGAGCTGAATTGGCGGAGCACGCAACGCGTCTG
GCTACATATTGATCATGCAAGTTGCTTTGATCAAGAATGGGCCTAAGTGTCCTTCCTCTCTCGTGTACCCGCCCCTAGTACTAGCGTGATACACTGCCAA
TAGCCAATTTTGTGCAAGAGGTTCGTACAGCAAACCTCTGCAAATCTTATGCCCCCCTCGCGAATTTTTTATTTGAAATGTGCGTTTTCTCCTTAGCAGA
GGTAACACGTAACCAACCTATGTATTTGCGTGTTTGGTTACTGGTATCTACTCAACTTTGTTGATCGAGATTACATTAACTTACATGCTTTACGCTTTAA
CGCATCATTACGTGAGCAAATTGACGCAACAACCTTTACTGATAAAAAAAAAGTGAGGCAAAGGTGTGCTGTGCTATGGAACCAGGTCATGACCGTAGTG
ATCTCTTCGGCGGGCGCATTTGGGACATGCGAATAGTTGCCCACAAGTGTTGTCGATTTCTGCAATAGCAGATCCTGCGGACATTCGAAGACCGTAAATC
GCTAACAGTATAGCCGTCCAGAAGGCCACGACAAATGTTGGCGCGATCTTGAAGCGCCTTGAAGAAAGACGGTCTTTACCAGACATTAAAGCTTTTCGAG
CCTAGACTGCTTTTGACTCAAAGAGTGTTCTTGCGGTGACGTGTGACCCCCCAATGAAAATGCTCACTTTGCATATTATTGTATTATGTTTTACTAGACC
GTCTTCGACTTAACTGGGAAACACTACTTTATACGTAACGAAAGGTACTAGAAATAGATATCAGAGATTCAGTCACTGCGTAGTTGAATGTGCTTAGTAC
AACACAAGTACCTGTTAGTAGAAGCCTTATTCTGCAGGCTCCACCAAGATACTAGCGGACCAATGGACAACAATATGTTCTGGTACTACGGGATACAAAC
TGAAAAGAGGAAAGAAAACGGCTCCAAGTAGCCACGCTTATTGAAGACCGACAGTCCAACATTTTTTGATATACAGCACATGTCCCAACCTTCATACGAG
GGGTGGTAATAGAACGAATCAGATTACATGGAGAATTAATAGCCCATTTGATGATTATAGTATATTA