Description :
From Genome Similarity Track
Location :
Scaffold_60:62652- 67562
Sequence
4910 bases(100 bases per row)
TCACCGGAAGAAGTCTCGTAATGGTGATACGGCCTAAGGCGACCAACGTAGAACTTAGGATGCGTGCGCATCTTACGTGGCACTTCAATCGTATATACGT
TGCCTAGGCGGCGCAGCACACGAAATGGACCGATGAACTTAGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGA
TAGTAGAACTAGGTCACCTTCATTGAATGAAAGAACGTTTTCTCTGGTTTACCGTAGATAGTAGGACTAGGTCACCTTCATTGAATGAAAGAACGTTTTC
TCTTCCATTCTTGTCATCATTTTTCTTTTGTCGGTCCACCGCTTCTGCAATGGAATCTTGCACGAAACGAACAACCGTTTCGCGAGCCAGTATGAATTCA
TCCGCTGACTCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGCAGCAAGATCATTGACCTGGGTAATAAGAGCACCCTCGCTCTTACTTTCCTCTT
CTTCACCGAAGTCGATGTAATCCTTTGGGTCAGTAAGTGAAGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCCCCCCCTCAAACTAGAGTT
ACACTTTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAGTTCC
ACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCTCGAAGGATTTCCTCAAGAACGCGGTTTGCACGATCTGTCTGACCATCTGTTT
CAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTTTTGAACACGGATCGCCAGGATTTAGCAGTGAACCGTGGGTCTAGATCAGAGACGAG
TTTCACGAGGCAACTCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAGGTGTACGTC
TATCAACGAACATAGGAATACCCGTATTCTTGTTTGGGTCTGCGGGGGATCCAAAGACAATGTCCATTGAGACTGATTCCCAGCAATCTGCCGGAATGGG
TAAAGGTCGCAACGGCGCACGAAGTGAAGGACCTGACTTACCCCGTTGACATACTTCGCATGCGCGGACGTACTTACGCACGAACTAATACTGGCGGGGC
CAGTAAAAATCGCGACTTACTTTGAGATATGTCTTCTCTCGACACAATGTCCACCAGTAGGTGCGTCGTGGTACTCATACATGATGCGCAGTCGCAGGTC
ACCATGGTCCGGTACGACGACACGAGGCGTGTCGCCGGCAACGCCTGTATACTTCAGTAAGCCATTGTGGACTGTATATGAATCCGTGGAGGATCGATAT
ACTGGGGGCAACCTTTTAAGGGATTAACGGGATGGTTGCGAGAGACCCATCAAAAGCACCATCACCGGATCGTACGCCTTGCGTATGTCTTCGAATAAGG
TTGACGACGGGACACTCGACGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGCTGCGCAGCCGGTTCGAATTCGGGCCTGTGCGAATGAGCATCAGC
GACGACATTCAGTCTTACTGGCTTATATTCCACGGAGAAGTTATAATCCGCGAAGAACGACAGCCACCTCGCCATTCGTTGCTAGAGGTGTGGACTGTTA
ACGGCCGTGCGTAAGGACGCGTGGTCCGTGTAGACGATGAAGGGTCTATCACCTGGCAGGTAGCAATTTCGCCAAAGCGTACTTCATGGCAAGGAGTTCC
TTGTCATGGACTGGATAGTTACGTTCAGTTGGTTGCATCTGACGTAACTGATAGCAGACGACACGTTCAGCACCGTCTGTGTCATACTGCATTAGTGCAC
ATCCGATGACAAAATCACTTGCATCGCAGACCACAAGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACC
TTCGAAGGAGCGCTGACAATCTGCACTACATGCTCACTTCTCGTTCTTTTGCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTAT
TTGTGCAAATACGCCGCTAGACCAAGGAACTTCCGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCGGTGATCGCCTTGATCTTTTCCGGATAGAGCC
GGACGCCGTGCTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTGGCAGCAAATATACACTTCTTGAGGTTGGCATACATCTTGTGCTCACGCATCAG
TGTAAAAACCTTTCGGACGTGGAGTCAGTGGACTTCCAAATCCGTCTGTTCATCCATAGCCCGGCTATGGACGAACACGTCATCGAAATAGCTGGGTGCG
AATTCTCGCACAGATCTCAACAGATTCATAACGCATCTGTTGAACGTTGCAGGGGCATTGCTTAATCCCTCTGGCATTACTAATCACTCGCAAAGCATAC
CACTTGGGATGCTCACTGGGGGTGTAAGGAATGTCCTTTTCACGCATAAGGATACAATTGAACCCGTCCATCAGATCCATCGATGAAAGATGGTACTCCT
TGCCATACCATCTATAATGACATCCTTTCTTGGTATTGGCATTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCACCATCCT
CCTGTGGCCTTTCGGACATAGAAGGTCGGAGATCTATGTGGGGAATTAGGTTCTCTCGTATGGTCCGCTGCCAAGCGATCGGCAAAGAATATGTCAATCG
CTAGTACTTGTTCACGAGGCAGTGGTCATTGCTTCATGACACAGTACTTTGACCCTAGTTTCAGGTAGATCTCATGACGAGTACCCTTATCCTTGGGTAG
CTCTCACGGCACTGTTTCTGGGACACATCTGTGAAATCCGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACAATTGGGATGTGTATCGCT
CAATCCGAGTCTTCTCATCAAGTACACTCTCTTCCATTGATGAGCTGCTGAAAACCCTTTCGTTCTCAGACAATACCATTGCCGACCGAATATCGGTTAC
GTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTTCCACTACGCAGATCACGCAAGAATATTTTCTGTTCGAGCGTGGGCAACTGAGTAATC
TCCGAAGTTGTCTTCGGAAGCGCGATCAGATCAAGTTGGTAAGTTCCTATACTTGATCCGTCATTTTCTAGGACATTTAATGTCTCTGTTGTCTCCTGGG
AACTTATTTCCACAGTTGGGTGGGGACTTATTGCCTCACTAGCCTCTTGGGATAAATCATCATTCGACACGAGTGGAATTGCTCCCTCGTTATCCTCTGG
CGGTGGTTGCGCCACCGCCGCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCAAAGGCAATCGGTTCATTTCACTTG
GGTGTTGTCGTTTGGAGGACACCCATGCCCCAGTCCACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCGATCTGCATCTTAATGCAGTCGCCGGAATCT
AACGACCGAACCACACGCGAGGCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCGTTCGTCAGATGGTCATCTGATGAACTAG
TGACAGACATATCGACTGTCCGTCGATGCCAGCTGACTTGCGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGAATGACATCAAATTTGTCATCCAAGTC
TAAAAATATGATGAAGTCATCATTATATTGAACCCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACAGATGCGCCTGTCGCGAGG
CGCACCGTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTTTGTTGTCTAGCGATTAGCGTCGTACAAAGTTGTTCGACTCCCCACACT
CGACTAAGGCTCGAAGCGACATGCTTTGTGTCACTTCGAATTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGTAACACACAATGACTGAGTGTT
GGGAGCAATTTTCATCAAGAGGCCTGCAAACTCACTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGT
TACGTTGTTGCGTTTTCGCAATAACGTCGGACCCACGCCTTGGACCACGTTTGGCCTCTTGGCGGTTACTGTTTCCTGCGATACGTGGTACCGTGCTCGG
GGCACTGCACTCATATGCATAATGCCCTGTCTTCTGACATCTATTGCATTTTTGCACTTTCTGTAGTTGTTAACACGAGAGCTCTCGCTCCTCGCATGAC
AGAGGTCCATTGGTTCTGGACCTCCATTTTCCTGTCGTCTTGACGAACTATAGGATTTTGAATTCGCGTGAGCCTGTTTCAAGCTGAAGTCCTCCTGTTC
CGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCCAATCGGAACAGGTATGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAAC
GTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACATCACGTTTACCTTGCTTGATTCTCAGGA
GTTCAGAGAGAGCCCTGAACTCCGCTCGAGGAGGCTCAAAAGTTTGCCTTAGCAGGGACTTCAAGACTTCCAACGACCCAAAGACATATGGTTCGTGTAA
CTTAAGGCCCAAGGCCCACGTCCTGCCAAGTTCAATTGAGCAAATGCAATCTGCATTTCCTCATCGACGATATGACGAACCCTTATGGCATCGTCTAGTT
TCACGAACCA