Description :
From Genome Similarity Track
Location :
Scaffold_18:626503- 631912
Transcript NameFunction/comments
Physo_344301guanylate cyclase

Sequence
5409 bases(100 bases per row)
ACGTGATAGTTCAAGGATAGATAATATACTGCAAGGATAAACTTAAGTGAAAGATATTATATCTGTAATATCGTACGAATGTGTTACTTTGATGCTTACT
GTGACTTGACGAAAATTGGTATTCCATAGCAACAATTCGCACGATCGTACGACTTTACTTCCCAGTAATACAACTCGTTCTTGTGCGCTATTATTGATAC
TGACGCAATGTAAATGAAAGAAGTATATACAACAAATTTATTATCATTTGCTGCTTAGACCATTTCATCAAAATAAAGTGAAAAAAATATTTTTAATTAC
TCAAAAATGAAGAAAATAAAGCTGTATGGCTAGCCGGATGGCTACATCCGAATGGGAACTCTACACGTAGGGCAGTTAGCTACATTTTCGGCCTGAATGC
TTCTCGCCACGTACATTGACATGCACTCGGCACACATGGCATGTCAGCATGAGCGCGGGGTGACCGGCGCCACTGGCGCGTACTAGCAAATGGCGCAAGT
TGATAGGTCCTCGTCTTGGTCCTCCTCCCCCGTAATGTCGATCACCGTTGGGGGAGCTGGTGCCGAGAAAACACGACGTCGTCGAGCAGAGCGGGGAGGT
GAGCTCTGAGCTGTTGTTGAACCCCCTAACTCAATGTCCCCAGGCACAGACAGGACGAGCGACTCAACAACAGTCGTGGTCACGTCACCTGCGGCTGTAG
TGATGATACGCAGGTCAAGCTCGTTAAGCGCGTCACGGCGAGCGCGGTGGTACAGCTTATCGTACTCGCGCTTGTAGCCTCGGGCCTTTTCCAGTCGCTG
AGCCTTTAGGATCGGGTACCGCTTTTCCAGGCACGCACGCTTGCCAACGAGCTGCCGCAGACTTGAGACAACCCAGTTGGTGTTGCACAGGGGGCAGTTG
GCACCATGATGTTTTCAATAATGAGGCACCTACTTATTTTGTTATCGCTGATGTTCCTTTTGCTCGTCCTCCATCATCTTCATATCTTACCCTGTCCTTA
ATTCTTATCGCGTTTTCAAGTTCTGATAAAACGTTATTTTTGACTGTGGCAATCTACTTGCAAGTTGATGCATTCACCTACTTAGACTTTTACAAAAATG
CTTCAATCTACTTGAATTACTTAATTCCTCCATATGCGCACTACTTATTAGGGCATCTCCACCGGTGCTGAGTAAAACTAAAAGCAAATTGCCCTAAGAT
CCGTGCCTACAACGGCACAACCGTGCTAAAGACAGTGCGCAGCTCCACCGGCAATTGAGACTCGCAGCAAGCGCGTTATAGCTCTTGGTTCGGCGCCAGC
CATGGCGACGGCGCACAGCTGTATAGCCCTATAAAGGGCCCGGCAGCACGTTGAGGAAGACCCAGGGATGACGTAGCAAGGGCGACACTGCGGTCTGTGA
CGCTTGCGCTGCTTAGAACGCTTGACTTGGCCCTACTACTGGTCGGTCGACATTTACATGTACTCAACCTTTTACTCAAAGCCTCCTCCGTTGGCAAACT
TGTGCAAAACTTTGATCTGCGTAAAAAATGGAGCAATTTGCTCAGCATTTACTCAAACCGGTGGAGCTGTACAAAACTAAAACTATGATTAAATATTGAC
AGAAAAGGGGTAAAATTTAGTTTTACTCACGACCGGTGGAGATGCTCCTAGTGCTGATTCATACTCTTTCGTAAGACGATACTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCAGGTCTGCT
CTCCACGACAGCGGCATCGGTTGCCGCGGACGCGGTGGCAACGTTGAGCGCCGAAACGATGCAGTTGCATGGTGCGGTAGGGTAAGTAGCCTCCTGTTCA
CACACGAAGCGATGTGCCTGTAGTTGGCCGCTGGCAGCAAGCTTAAATATCGGCATAATGACTGCACGAACGCGTGCATGCAGTCCGTGGAGCTGTTCCA
CTCAGAGGTGCAGCCGTTGTAGGGCACGGAGTTACGATGAAGTTTGTAGACGTAGACTAAGAGGGACAAATTGCTCGTAACGGTACTACATGTACATTTT
AATGTAGTAATTTTTATGCTTGAGCGTACATCATAGTAGTTGTGAAGGCGAGGCAGCCAGGGAACGGTGTTGCCAGTGGGCTTCCCGAGATCCTCCGACC
CCCTCTTACCTAATCATTACAGTCCAGCAACAAAATGCAACCACGTACTCTGCAACGGCGATAACACCTAGATATTGTACCTACGACGCTGAGGTGCGGA
GGAGCTCCACACTGCTGCGCGGGCGCTCGGCGCGCGCCATATCGCTGCTGGGCTCGACCTTCGGCATCGGCGAGTTACTCGGTATCTCCTGCAACTAAGC
CACTGCCTGCAGCCATGCTTTTTGTCGATGCTACAGCGTAGACTGGTTTGCGTATGCGCCCTCTATCCGAATCTCCATCTTCTATGTAGTGTTAGTACTT
TACTGTAGAAAGGAGAGTTGGCGTGGTGGGGTGAACGACTGTTGTCGTTCACCCCAGTAAAGCGAAGAAACATTGCTCCACTACGGGAACAAACGGTCGC
ATGATAACTGTGCTATGATGTCCTTACATTCCATTCCTGGCAAGTATATTTAAATCTTCTAGCAGGAGGTTAGTGCATGGCGTCAGGATCAAAAGCCCGG
ACATTTTTCAAGTGCGCTGCCTCTAGTAAAGGGGCAAAATGCGCACACAGATGAATCAGTCCAATTTACGAGCCGAGATGCAGCAACACTCAAAACTACA
TAATACAATATTAACCAATGAAATTGCTACATTTGATTTGTCGTCAAACTGTCTTACGAATGCTCGACACAAGTGATTGACCATCCACGACTTACAGCAA
TTCGTACTCGAGTACGATTTATAGTCGTACTCGATAAGTCGTACGAGTTATTGTGCTTTGCAGTTATTTTGCCGACCATTTTAGACGCTAAATATGGCAA
AGCCTGCTCCTAAATATGTGTGAAAGAAGATACACGGCCTGCTAAAATTATGCATAAATCCACCTCCTCATATATATATCGACTTGGGAGGGCCTGTCAG
CAGCCATGCATTGGCCCAGTACACCACCGTCCATGATCCCCAGCACATCCACCCTCTTATGCATAATTGCCGTGTGTGTAGGTGCTTGTGGATAAAAACC
GACAGAATTGCAGCTGCACAGCCACAATTGCACTTTTGAAAGTGCAATTATGGCGCTTTTAGCGTAATTCTAGGCCTCCACCCATTTATGCACCTCGATT
TATCGTAAATCTAGCAGGTGGTCGTAATAATACAGCAAATCTCGCCTCATATTGCCAAAATCATTGCAAAGCACAAATACAGTCTGAAGTGCCAAAAAGT
ACAATATGTGTTATTATAATAAACCTGGCGAGATGTGCGCCTAAATACTTTTGTCCAATAAAAACAGAAACTACATAGTGATTATGTCCAATTAAAGCGA
ATATGTGGTCTACATTAAAGAGAAGTCGCCAAACCGCAACACTGCCGCTCTGCTGGACATGGCGAGCCAGTCGGATCTCCAGCCTGGAGTCGAGGAGATA
GCCGCATTCGTGGACGACAGCGTCTTCACTCAGTTGAGCGCGAAACTGGGGGACGCGAAGGAAGGCAACGAGGGAGCACTGGAGAAGAAGCCTCTTCGCA
TCGATGAGTATTTGAAAAAATATCGCGACGCGGGACTCCGGGTCTCTCAGAAAGAATTTAATGGATGCTTGGAGGTGAAGATTGGGATCGTATACGAGCA
CCCAGACGTGACGGTCGATCTTGCGGAAACCATTACGGTCAAGACGATTGAAGACCTCCTGGCAAAGTTTGTTCCGGAAGACAACCCCCTCATCACCAAG
CTGGGTGAAGACGAAATGATTCGACTCTCGGATGCGTTCACTAAAGTCACGTACGTCGGCAAGGCCCAAGACGACCTCGCAGAATACCTGCGGGACTGCT
GGAAAGAGTACAACCCTGCAAAGTACAAGGCGCCATGTGTGGCGGTTGTGCAGAGTTCCGGCTTCGGCAAGAGTCGGACAGTGCGTTAGCTTGCGCTCAA
GGCAGAACGAGAACCGAACTTGAACCTGAAAGTTTTGTACATGTGCGCGCGTGTGCACCGATCGACGGGGTTTCCGGAGGCTACGAGTAAGCTTCGTGAT
TGGCTGTTT