Description :
From Genome Similarity Track
Location :
Scaffold_122:62640- 64361
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14279Hypothetical protein
Sappa_CBS223.65SPRG_21394Hypothetical protein

Sequence
1721 bases(100 bases per row)
GGGAAGGTGGCGGGGAAGGTCGGTGGCCGCGCAGATGGCGGCGATGCGCGCCTCCAGCGACGAGAGCAAGGTTTCGTCCATCTTCGTTGGGCGTCACAGA
TAATGCACTGTCCTCTTGTTTGTATGCCCATACAAAAACAACGTGCGGCAAAAGATTTTGAGTTTGATTTTGATTGTGGGTCGTCTACTCGGCGCAGGTC
TCACGGAAGCGCTGCATCTCGCGCTCGTTGGCTTCGACCTGCGGCCGTGCTTCCAGCCGCCACTGCCATGACAACAAGATGAGACATTGGCCATGAGACC
ATGGGATATACCTGCTCAATGTCGTCAAAGGTGTAGAGCTTGGGCGACGGGGCGACGGCTGGCGCTGCGCTCTTGTCGAGGAACCGCGTGACTTTGGCCA
CGAGCTGGTCCAAGGGCCCGGTCGGCGCCTTGCGCTCGTTCTGCATGAACGCGTGCACAAACTACAATGCAAATGGTCAGGCTATGTAGCCTCGGTTGCG
TCGCCACACCTCGGCAAAGGCGTCGGCGTCATGCAGCTCGGTCCCGAGCTCCCGCACGCGCTGGAAGAGCTCTGCGTGCGACGCGACGCCCATGATGTCT
TGCTCGCCCAGCTGCAGGACGCAGAGCGCGGCGTCGAAGACGACCTCTTGGCCGTAGAAGAGGAGGAGGTCCCATACGCGCAGTGCCGTCTCGAGGGGCA
GCGTGCAGAGGAAGACGCAGAGAAACCACTGGAGAGACACGAGTTCGATGTCGATGCCGTGCGTCTCGAGCATCGCGCTGAGCGCCGGCGCTTGGAGCTT
CACGAGCCGCTTGAAGACGATCTGGTCGACTTGGGCGCCGACCATGCTCCGCCTAGCGCGACGTCAACCCGTCGCATGGCAATTCCATTGTCATACGAGT
AGTTCTCCCACGGCAGAAACTTGTCCAAGAGCACGGCGAGGAGCCAGAACGCGTCTTCTTCGGGCAGGAAGAGCACGAGGATGCCCACGATAAAGTTCAT
GGACTGGCAGTACCCGATCTCGCGCCGGTGCATCGCGTACGCCAAAAGCACGTTGGTGAGCTCGACCTTGCCGCGCTCCGCCTACGCAATCATCTTGGCT
CGGCGCAGATCTACCGTCTATAGTATACCTGGAAGAACGTGTGCTCGGGGTACGTGCGCCCAACGTCCTTCTCAATGTCGTCGACCGTCTAGACCAGCGG
GATGCGCACGGCGCAATCTAGATAGGAATACGCACGCTGCCTCGGTGGTCTTCGCGATGGAGGAGGCCTACATAAATATCCCTGTGAATAAGACCCATAC
TAAGTTCTAGCAGCACTTTGGTAGTAGTCGAGTGGGAAGCGCGCCTTGTAGGTCGCGACATTCGCCAACAAGAGCCACATGGCGGGGCGATAGGCCGACG
GAATGCCGCCAACGACGAGCGGCTAAGACACTCTCTGTAAGTGGATCATGCGATGTGTTGCGGAGGTGGTGAGACCTGGAGGAGCTCGCGGACGTGCGTA
CTCTCATCCTCGGAGCTCTCGTGCAGCGAGACCTGGAGGCCGTCGAAGCCTCCGTTCTCTTGGAGCAGCTCCAGCCACTGCTTTTCGTGCTTATATCGCT
ACACGCTCGCTCTAGGACACCATACGACGGAGACGATGCTTACCGCAGGCTTCTCGCGTTGGTGGCGCAACTGCTGTCGGTGCTTCAGAATGTACTTGTC
ATCCTTTGCAAAGCCATACTC