Description :
From Genome Similarity Track
Location :
Scaffold_122:62640- 64352
Transcript NameFunction/comments
Sapdi_VS20SDRG_16296hypothetical protein

Sequence
1712 bases(100 bases per row)
ACGCTTGGCGCTCGTAGATGAGCAAGTACGACTCGGAGATGCCAATGAGCTGCGGCATGGTCTCTTGCACGTGGAGGTCCTGGAGCTCGTACCACTGGTC
CGTCGCGCGGTTCTGCACATGCACGCGGTACGAGCCGTCGGCGAGCGGATCCATGTTGACGGCGGTCGTCGCTTGACCAATCGTGGGCGGGCTGTCGTGG
CACACGTTCGCAACCAGGTTGTACTTGGTCGACGGCAGCTTGGAGAGGACGCTCGTGACCAAGTGCTGGCGCTCGAGGATGCCGGCGCTCGAGCCGCCGA
GCGACGTAAGGAGCGCTTTGAGCTCGCCAATGGACATGGCCGCGATCGCGTCGCTGGACATGCCGAGCTCGACGTGGTCGCTCATCTCAAGGTTCTTGAC
GGGGAAATTCACGATCGTCGGGTTTTTCTCCGTGAAAAAGTTGTTTTTTGTAAACCGGTGGATGTGGAAGATGAGGTACTTGGGCAGCGTCTCGAGCGTA
TACTGCTTTTGCTGCCGGACCGCGCCTTGAAACACGTGCTAACGCCATACTCAAGAGTCCGAGAGCGTCGGCAGATCGCGTACCGTGATCTTTTCGCCGT
TGAATTTTTCGAGCACCGTAAAGAGCGGAACCTGCGGAATGACATTGCCGCCCTGCGAGTCCTTGAAGAGCGGCGTCGGCGGCAAATCCAGCGAGAGAAA
CCTACAAATCCCATTCGAGTCCAGCGCCAATTTGCGGGAAAATCTGTACAGGAACGGCGTCGTGGCGTTGGTGACGCCGGCCGCTGCGCCGTCCGAGAGC
GTCTTGACTTGCACCGTGCCCTGAAAGACGTCGTGGATGATGCTACTGCCTTGCTTTTTCGTGCCGCCGACGCCCTACACCGGATATTTACGCTAAATTG
GGTTTTGTCATTTGAGAAATACGCGATGGAGCTCGTTGAGGAACCACGAGAGGAACTCGAGTGCGTCCTTTTGCTCGCCAATGTGGAAGCGCTTCTTGCT
CGCGACCGAGATTTCTTGGACAATCTCATGCGGACTGATCTGGCCGACAGCATGAATACCGTCGATTTCCAGGACAAGAGGCGAATTTACCGTATTTTTG
ATGTTGTGGGGGCTCCACATCTTGCGCATCATCTCGCCAAAGCGCAGAGCGAGGGTCGACTTGGTCTTGGCGACGGCCGCCATGTAGTTGGCTGGCTCGA
GAAAGTAGTCGCGGAGCGGCGGGACGTGCGCGAGCGCATGCAGCACGACCGAGACGTAGTCGGTCTTCTTGAGGTTGTTGAGGCCGACAAAGCCCGGGAG
GTACGAGACGCCAAAGCTGTCTTGGGCGAGCTTCCGGTTCCCGTCCATCTGCGCAATCTGCTCCTTCGTGAACGTCGGGCGCAGCGCGTGCTGTATGGGC
AGGAGCGAGAGGTCGTTGACTTCGTAGTTGTCGGGCAGGCAGTAGATCTTGTCGGTTGACAAGTTGATGAAGACGTGGTGGAAGCTCTGGAGCGCGTGCA
TGTACGCGTGTGTCTTGGGGCCGCGGCCCTGGAAGTACTTGCCGCAGACCAAGCACGCGTACGCGTTCTGCGCCGAGAGCGAGACCGAGCAAACCTTCTC
AAAGTCAAAGTCCAGCAGCTGCGGCTTGACCGTGTCCAGGTACGGGCAGCGCTTCCGCTTGTTCATGCTCGTCGCCGGCGTCTCGTCGTCGGGCTCGGGC
TCCTTGCGCTTG