Description :
From Genome Similarity Track
Location :
Scaffold_92:62640- 64167
Transcript NameFunction/comments
Phyci_236299Hypothetical protein

Sequence
1527 bases(100 bases per row)
catagactagtgaattgaacgcttataaattcaagaaaggtacacaatatttaatagaggagggtatattaatactattagggctaaaaggtaatgttgt
ccagattttcgagtagttcgtccgcgaagtcttcaccgtcggagttcttgtcgcgagTGTGGtagtctgggaatctacatcttgagcgttttattgagcg
tgacggcatgatCAAACTCCAggaaatgacagatttgggcactattccgtaaaagtttccaaattgtgcgccaaatgacaTGTCATTTACGGAATAATGC
CCGAATCTGTCATTCCCCTCAAACTCCAACAAATCATCAACTGTGCAGTTTGAGTTTGGTAAAAATGGCGAAAATGCGCcccttttagcaggggtattcg
tacgttgctttgcaaaacactataaagggcgaaaactgcgccctttcgtcgcgaaagggttaaAAAGTTCCCGTCGtaacggatagcaccaaatatcgta
cccttcccgaattgaacacatctcaaatctgatagaaattgttgagtatacaaagctattgtacctgcaccaatttgtatacctcaACAAGCTTCAGCAA
AGAACAAATATTAGGACAAAACCGATACTGACTTAATTTCAGAATATTTTTGTATAGTTTTGGTACTTTGTCCTAAAATTCGAAAATATATAAGTTTGCC
CTTTTATTTTGCTTTTTAGGGGCAACAATCTCCATTaaacagcttgtaaagacgtatacgatacgacattgtgagtcgctctgcaacaccaccagggctt
tccccgtggtttgaggactgatccagcagtcgccacgacgtctatgCTCGTATGCGTACACAATTCGGCGTTATCCGTTATATTATTTATTGAGTACATT
CCCGACATTCGAAGCCCATGCACAGCTTTTAAGTAATCAATAACTCCCACATATGCACATCACCTGTACTACAGATCGTAAGTGTGTTTTGCGTATTGTC
AACTGCGCTTGCGTGAAGGACAACAACATAACTTTAAATCTCCCAACCACCACCTGTTGCCTCAGAAAATTGACGTTCGCCTGCCCAACTAGGATTACGT
GAAGTGAGTTCATTCGGATTCGAACCTGTGCCTATGAAGCATTAGTTGCAGCTTCAGTGTTCCCCTTTGCAGCTAGCCAATTCTCAGTCTTATAGTCATC
GCCTTGTGGGCCCTACGAGTGCCCCTTGTTTGCTCGCTTCCTTTCAGTCATTTGCATGTGCCATGACGACGCGGCTCAAAGTCAAGCTGGGACGATGCGA
TCAACCAAAGTGATGGCAGAAGAATGTTGCGAGGCTGCGATCAGTGCTGCCAACGAGAGTCTTCATACCACAGCAGAGCCCGTTTTACTTTTTTTTGTGG
TGCCACGAAGAACGAGGTCTGGTTGCAGTGAATATGAAAGCCACCTTTGCCCGGATGCAGAGAGCTCGGAACATTCGTGGGAACCCAGCCATCGTGGAGC
AGCCTGAGGTGCCAGTGCCAGTGCCAA