Description :
From Genome Similarity Track
Location :
Scaffold_834:6264- 8150
Transcript NameFunction/comments
Phyag_g8284hypothetical protein PHYSODRAFT_318067

Sequence
1886 bases(100 bases per row)
CACGCTTGGtctccagttcctccagAATCCCTTCACGGAAGTAAACACGGGTCAGACCCACCTGGTAGTCCTGAATATTGCGTcctggcagcagcttctc
catcaactCTTCACACTGGGACTTGATGTGTCCCGTGTCAGAGTCACTCACAAACTTGTTTTGCGTTGGAACTGCACCTGTAAGCAGCACGCGGAATTTC
TTAATGCACTCCAGATGAGGCATGCGACTGGGGTATGCACTGCGAGACACACGGATGGCCTCAATGACACCGGCGCAACGCAGCTGACCCACAATATCTC
CATGCGAGAAGCAGTGGGCACTCTTCAGAGGGTTGGGCTTCAGACAGCGCACGTAGTGTACTTCTGTGAGTCCGATCTTTTCCATCAGCTGGGACAGACT
CTCCTTGAATTGTGTGCCAACCGTAGTCCGGCGTGCTTGGCCGTGCCCTCCCTTCTTCGTACTGCTACTGCGCGTTCTGCCCCGAGCACTAGATCCACTG
TTGTTGGTATTACCGGCGTTCACATCGTCCGTGAACATTTTGGACAagatcttgagcttggacTTGCTCATACACTGCTTGATGTCCGGCAGAATGGCGT
CACGGTGCTTGTCGAGGAAGCCCGATGCATCGTAGGTCACCTTACCAGCGTAGTGGTAGATGGAGAACGCGCACTTGTTGAGCCGAGGGGTCTCCAGCAG
AGGGTTATTTTCCATCACAGCACCCAGCTTGCTTGCGAATGACGCGTCTGTACCCGTGGCAAGCAGCGATTCCTcgttcaagaagctgatgacACCCAGG
CGGCCTTCGATGAGATTCAGCACGTCCTGGTTGTCTGCAAAAGTGATGTGCGACCAAGAGAtattctcctcctcgtatTCGATTTGTACAGTTTTGAGCA
CATCTTGCACGAATTtctgttgcagcttctcgttggcGTAGTTGATGCAGAACTGCTCGAACGAGTTGGTCTCGAAGTGTTCAAAACCGAAGATATCCAG
AATACCGATAAACGATCCAGCACCCTTGGTCTTAACGCCGATCGTCTCGTTAATTTGCTCCACGAGCCACAGGAACAGCTTCGAGTACAGGCTCTTCGCC
AGCGCATCACGACAATCGGTCGCCTGGTCATGCGTCATCGGCTTCAGAATTACCTCGCGACCCACGAACACATTACGGTTGCACACAGCGCGCTCCAGCG
CATCGACTTCAACGCCGAGAAGGCGAAAAGCCACAGTGAAGTGCTTCAGATCCTTCAACTGCGAGGCGTCCACGTCTCCGTTTCGCGTGGTGAACTCAGT
CTCCCCCAAATGCAGCACAGCGCCCAAAATCTGCATAATTtcctgctgcaatggctgtTCAATGCCgacaagctccagcgcctctCGCGTGCGACTAaga
tcgccttcttcatcgccaccgGGGGCTTCTGTCTGCATCGAAACGTACTTGAACGAGTCCACCATATCAAGTTCCAACTCTGGGAACTGTTTGCGTTGCG
TCAGCAATTGGTAGAAAATGTGGAAGTTGCGTTCTCCCGCAGCTTGTGTCGTGACTCGactcttctccagcagatacGTACGCGACCTGGCACCGATCAA
CTGTCCTTCAATAGTAAACTGGAGCTCTGTGAATTTACCGAAACGACTGGAATTGTCGTTGCGCACCGTCTTGGCGTTGCCAAAggactcgagcagcgga
TTGGCCTGGATAATTTGCTGGATGACCTTCGAGTTGGAGTTGGTGGCCAAAGCAGCCAAGTGGCTCATGACGATCTTGGTGGTCTCCGTTTTACCTGCTC
CGGACTCTCCCGACACCAAAATACTCTggttctcctgcttctgccGCATGTTGAAGAAAGCTTCCATGGACACAGCGTAGACGTGT