Description :
From Genome Similarity Track
Location :
scaffold_6:626375- 630095
Sequence
3720 bases(100 bases per row)
GCGCCGCTGCTACTGGCCGTCTTCGCTCTTACCTTCTTGGGATCGTTCGAATTAACGACCTTTCTAGCACCAGCGGTTATCCAAAAGATCACCCTTTGCC
TGATGCCAACCCGGCAAAGACACTCTGCAACTCTGAGCATTATGAAGCGGTTTTTCACAACGGAGACATATTCCATAGTTACGAGGTTCATCACGTGTAC
CACTCAACTGACGTGCTTGTCTTGGTGCGAAGCCATTAAGCTTGGTTTGCTCAATGCTGTACTCTTCTTACGTCGCACAATTAATGGCTTCGTCAAGCGT
ATTGAGGAAATCAATGATGAGATGATTTTAGATCGGCGCATCATTTAAACTCGCCAGAAACACTACAACTTGCCTTGAATTATCAACTGGTTTGTCACAT
ATTCTTAATACCTAGTAGTAAGCACGCTGTGGATTCGAGTGTAGGTCGAAAGACTTTGATCAAGCTTTAAGAACTCGTCACGGGCGCGGAACTTACTCTG
TGGTGGTTCAAACGCCTTATTGAGCTTGATTTTGTAGTTGTCCTAGCTAAAAAGCAGTTTGGACCGTCTAAACGCTTATCATACACTCAAAACTTCATAT
GACCCGCAAGGTTGGACATCTTGAACGACCCTTGCTGTAAAGGGTATTGCAGTTGTCTTGCTGTGAATGCTGCATTCAACTCGAAATTTTATCGTTTGGC
TCGTTTTTTCCACTACGGCCCAAAGATACTTTCAGCTATATAGACATCGTTCGGTAAAACGAAACACGGACTGCATTCAATCTGCTTCCGAGCTTCTGCA
GTGACATCATACATCTGCTCGAGTACCCCATACTCATGTGATGAGGAATGAGAAAACGTGTCATCTATCAGAACCCCAGTTTGCGGTACTGATGGACCGA
GTGGAACTGCAACTCCCTCCGCGTTGCTCGGACAAGGACAGCACTCTGAACTGGGCCGACATGCGCTGCGTGCTTATCAGCCGCGTCGTTAGACAAGATT
TGAGGTTCCTTGGCAagaccgctcggagtacaaTGAGGTATAAGACGGCGTTATTTGTGACAGTCTCGCAAGTACAACGCACGCGCTGTGTGACTAGGAA
GCGATTTCCGACGCAAAGGCAGAAGGTCAGACCCGACTTGGAAGGACGAGAACGACTCGAGGCCTTGTAGACAAATTCGTTGTGGTTCCTAGGTGTTCGA
CAAAACACCTAAACGTTTTACTCATTGAGCCTTGGTTCCAAAACAATTGATAGATGTTTACGGGGATTGAACCTCAGCTTGAACTCATACAAGATCATGG
GTGTACGGAAAAGCATGAATGGAGCTCTCGTGGTTACTACTAGCAATAGTGATTGGCTTATACCACCCACTTCAAAAGAcaaagacacgtcggtcttaTC
AACAGTCTAAATTCCCAAGTAGGAACCAGTGTTCTGTATCTCACAAAATGTTTGCGACCTCAGATATGCATGTGAGATCACGATAGTGTAATCCCTTACC
ACTACCGACAATGCCCACAGAAAGTACATAAATGTAGTGTGCCTTCATGATAACCTTAGCGAAGTCCATTACAAGAGTGGACTACTTGGAAGATCGGCTC
TTTCTAACCTCGTAAATATCGGGTTCAATAAGACTTAGCCCTCTCGGAACCGGCACTCATTTCGAATGGTGAAGTCTCACTTCAGAGTTATTAGATTATG
ATAACACCGCCCTGGGCTATGTGGAACGATGGGAAGTCCGGATTGATTTAGTCGTGCAATTACATACGATTGCGGCTTTGTAAGCATAGTTAGTGCGTAG
GTGCTCAAGTGACCCAGTTACAGGTATTACTtccgtgcgtcttgcgacAGGGACACTAGCGAGAGTGTAGAGATTTTTTGTCAACCCTTCTTGGAATTTG
AGCCTTTGACAGCGAGGAACGCTATCTGACTTGGAATGTAGATAGTGCTGGTTGCAACAAGCGGGGATTGGAAGGCAAAAGTGGTTGTGTTCCGCGGATA
TGAAATAGAGCAGAAAATTGCGTTTTCATTTTGCGATCCCATAAGATATACTAAGAGGGATGGCCAATGACAACTGTAACTCTTTTGTGCCTGAGCCGGT
CAATTTGCGGTGTAATTAAATGTTGCGCGAAGAAATGCCAGGCCTTTCAGTCATTGATTATGGTTCATTCTTGTCAATAATATTCGGTGATGCTGTtttc
acaccactgtgtgatgcGCCTACCATATAGAACACTGAAGCTTCGCAACTCTGTGGCGAGAAAGATTATTTGTCTGAGGACAAATAATCTTTTTTTGTCC
TCAGACAAATAATCTTTCTCGCCACAGAGTTGCGAAGCTTCAGTGTTCTTGGCTTTTTAGCTTCGGACTTTTTCTCGAGAAGTAATTGCAAAGAATTGCA
GGATAGTGAAGTGGCCGAGATGGTACGGTTGGTACTGGAGGGGGTAAAGAGCTCATCCGGCATGTGAGAGTCTGCTGTTAAGAACATTTAAGGAGTACCG
AGTATTAGGACTGGGACAGCTAACAACAGGAATCCTACGGATTGATTTTCTGAAGGATTGACAGAACGTGGATACATGGAACTCACCACGCGTGTCTCGA
GGCGAGATGTACGTCAGaaaattgacctggttcctgGAAAAACACAGCATCAAACATTAATGGCTGTTGGCATGACAGCAATATGCCATCATAGTCAAAA
TTTGtatgtgcgaagcacgaagcgCTTTGATGAGAAAAGCTGAATTTCTGGACTCGACTCTGGTTCTTTGTGTCAGAAATCTAACAGCATATGGCGAGTT
ATGCGTGCGTATGATAAGCGGGTTGCAGCCAAGATTCCGGCCCAAACGCTGATTTCTTGGTAATCATATTCTGCAGCACACAATGAAGTCCAGTGCACTT
GACCTGGTTGACATATATTTCTAACTGCTCGTGAAAGATAGCAATATCTACTCGCAGTGGTGAGTACCCCGACCGTGGTGTGCTCTGGGATCTGCTTGTA
ATCTCACAGGGACTGCATACTACACTCAAGATGCTCATTCGTCTGACGACGCAGTTGTCAGGTCACATCGTGAACGTATTTCGACACCATTGTTGAATTG
AGGACTCGCGGTAAATAGTTCTGTGCAGTGCCTCGATATATGCGCGATAATGAGCTCTTTGCCAATTAGGATAGGCGTGTCATGGCGTCAGCGATATTCC
CAATAGGTGTTGCTTGGTAGGGTGGCAGGAAACTCTACAGCGACCATCGTAGTAAACAAGCTTAATGACCCTGGTAGCATTGAGAAAGCGGACGAACCTG
GATAGATATGCATATGCATACAGCACAGTACAGATTATGCCGGCATGCCACGATTCCTCATCAACATTCCTTAAGGTAAGGTCAAACAATACTGAGTAGG
TGACCGTGAAGGCTGCAAAGAAAACTTTCATAAACTCCCTAGTTTTGGGTCTTCTTAAAGCAAAGCAGACGATTAACGTCGTCCGTCACTTTCAGTAGTT
GCAAATTTTATTGTTTACTTCAAGCATATGTCGATGGTCATTAACGTGATGAATCACGTTTGAGCCTCGCCCGCTAAAAGTAATTGAGAGTAGCTACCCT
CTTAATGATAAAAAGTAACTTGAAATACGGTGGAACAttgtcagcttctgggtggctccAACGTATTTGTGATCGATATAGATCAAGCATCGTTGCCCAG
ATTGACGTTGTCGCCACGAA