Description :
From Genome Similarity Track
Location :
Scaffold_205:6261- 13051
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.12Callose synthase

Sequence
6790 bases(100 bases per row)
CGCGAACAGAACGAGTCGTACAACCGCGGCGGCGGCAGCGAGTACCGCAAGCGCGCGAGCTCCAACTACTTTGAGCTCGATGCGGACCGACGCCGCAACA
AGTCGGAGCGCACGGAGCGCTTTAGCACGCGCCTCACGTCGCTCGACGTGCAGCAACCGCCGCTGAGTTCCAAGTCGTCGGAGGGCAAGTTCACGGATGA
CGACGAGTCGTCCATTGACGCGTGCAGTGAGATGCTGCACGCCAAGTTTGGCTTCCAGGAAGGCTCAGTGGCGAACCAGCGCGAGCACGTGCTGCTGCTG
CTCGCGAACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCCAAGCCCTCGGACGCGCCGGACCAGTACATCGTCGAGCTGCACAAGAAGCTC
TTCTCCAATTACCGCGACTGGTGCAAGTTCCTGAACGCGCAGCCGGTGCACTTTCGCGGCACGTCGGCAGCGCAGGTCAAGCACCCGCTGCACATGGACC
TGATGCTATACTTCCTCGTGTGGGGTGAAGCCGCGAACTTGCGCCACATGCCCGAGTGCCTGTGCTACATCTACCACCAGATGATGACGCTCGTGAACGC
TGACCCGAACATCCAAGAACGTAAGCCGGAAGGATGGTACCTAGAGAACGTTGTGCGTCCGATCTGGAGCGAGTGTAGCAACATGCAGCGCCGCAACAAC
TTGAAGAAGCCGCTCGAGCATGTGCAGATCCGCAACTACGACGATATCAACGAGTATTTCTGGAAGCAGCACTGCCTGAGCATCGACATCACACAAGTTG
GTCGTGAGCTTACCCAGAACCATGGCAAGACTTTCTACGAGCACCGCAGCATCTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACCTCAT
GTTTATGAACCTGCTCACGGTGCTCGCGTTCGCGGTCACGATCTCGCCGGATGGTGGGAAAGGCGGGTTTGTGCAGTTTGGAAGAATTGGTGACGTCGTT
GAGCCGTACACGACGCGCGACCTGAAGCTCGCAGTCGTGTCGATCCCGTTCTCGCACGCGCTGCTGGCGTTCCTCAAGTGTGTGCTGGAGGCGTGCCACG
GGTGGCACTTGCTGATCGCGAAGGAGAAGTCGGCTTCGTCGTCGCGCTCGCTCACATACGGCTCGGCGCTCGTGATCCGCATGCTCTGGAATGGCGGCTT
CGCGGTACTCTTCGGGTTCATGATCTTTGTGCCGCTGAACGAGCTGCGCGACACGGCACTCTTGGACCAGTTCTTGCCGATCACCGGCGGGTTCTTCGTC
CCGGGTTTGCTCGTGCTCCTGGTGCAAGCGTTCTCACCGCAGCTGATCTCGGGCACTTTTGCTGCCAAGTTTGTGCGTGAAGGGGAGAGCTGCTACGTCG
GTCGCAACATGGCGCCGCCGTTCTCGTACCAAATCAAATACATCACGTTCTGGCTGTTCCTCTGGACGATCAAGGCGCTCACGTCGTACTTCATCTTGGT
CCGTCCGCTGATGCTTCCAACGCTCGCGATCTACTCGATGAAGCTCGAGTACCAAAGCTCGCTCGTGTCGTTCCACAATATGGGAGTGATCCTGTCGCTG
TGGTTGCCAGTGGTGTTCATCTTCAACTACGACACGCAGATCTACTTCACAATCTTCCAGGCTTTGCTCGGCGCGTTCAAGGGCGTGTTGATGAAAACTG
GCGAGATCCGCGGAGTGAAGGAAATGTCCAAGGCGTTCCGCGTCGCTCCACAGCTGTTCGACCAGAAGGTCGTGACGACGTTGGCACGTGCGAGCGATGC
GTCTGCGAACGGCAACGACTCGTCTCGTCCAAGTGCGTTGGCGGCAGCGTACGAGTCGCAGATGATGCTTCGTTTCGTCGTGGTCTGGAACGAGATTGTC
AACTCTTTCCGCGAAGGCGACTTGCTCGATGACAAAGAGGCAGCGATTCTCCAGTACGACATCCGCAGCAACGGTGAAGTGTTTGAGCCTGTATTCCTGT
CGGCTGGCAAGCTCGGCGAAGCCATGAACTTGACGATCAAGACTGCAAAGGAAGGCAAGGGTGAGTCGCAGCTGCGCGTCGCGCTGGTCGAGAGCGACTG
TCTGTCTGCGCTCCGTAGCTTCTACACTGCGAGTTTCTACGTGCTGACGTCGCTCTTCGGTAACGACGACGCGGATGTCCTCGAAGGTTTCCGCATGATT
GAGGACATTGCGTCTGCGGGCGGCTTCATGAAGTCGTTCCACGTGCGCGAACTGGTGCGTCTTCGTGCTGCTGTCGTCGATCTCTTGGAAGAAATTTTGG
AGCTCCCAGATCCAGAGGTGCAATCGCAGCACATGCCTGGCGCTCGCGTGCACACGATGGGTGTTGTGCGCAACTTTGTGAGCAAGATGGAAGTTTTCTT
GAACACGCTCCAGGCGTTCTGTGTCGACCCTGCTCTGCAGCGTAAGTTTAGCAACTCCAAGTTCTGCTCCAGCACGAATGGCTACCTATACGCATCGCGC
GGTCTTGTGAACCTGTTTTGCAATGACAGCTCCATGGGTGCGGCGACTCGCGCGTGTCTGCTGCTGTCGTTGGAACGATCGGAAGCGATGCCGCGTTGTA
CGGAAGCGCAGCGTCGTCTGGGCTTTTTCATGAAGTCGTTGGTGATGGACATCCCGCAGCTGCAGGCGATCAAGGAGATGCNNNNNNNNNNATCGTTCTC
GGTTGTCACGCCATTCTACGCCGAGACTGTTCTCTTTTCACTGGAAGACCTGAACAACCCGCTTGTGAACCACCCGATCTTCGAGAAGGTTGAGGAAGAC
GGCAAGAACTTGACGATCCTCAAATACTTGACGAAAATCCACGAAGAAGAGTGGCTCAACTTTTTGGAACGAATGGACGTCAGCTCTCCTGAAGAAGCTC
AGAAGCAGTACCCTCTGGACATCCGTCTCTGGGCGTCGTACCGTGGCCAGACGCTTGCGCGTACGGTGCAGGGCATGATGATGTACGAAGATGCGATCAA
GATCTTGCACTGGTTGGAAATTGGTTCGAGCCCAGGCAAGTCTGCGGAGCAGAAGCAGACCCAGTTGCAAGACATGGTGCGTCTCAAGTTTTCGTACATT
TGCGCGTGCCAAGTGTACGGCAAGCACCGCAAGGAGAACAAACAGCAAGCCGACGACATTGACTACCTTTTGCAAGAGTACCCGAACCTGCGTGTCGCGT
ACGTAGACACGATTGACATGCAGAGCGGCGAAAAGACGTACGACACCGTGCTTATCAAGAGCGAGAATGGCGAGATCGCCGAAGTGTACCGTTACCAATT
GCCTGGCGATCCAGTGTTGGGCGAAGGCAAGCCTGAGAACCAGAACAACGCGTTGCAGTTCACGCGCGGCGAGTTTGTGCAGACGATTGATATGAACCAG
CAACACTATTTTGAAGAATGTCTGAAGATGCCGCAGATGCTGCGCACCGCGGACTTGCACCCATCGAAGAAGCCAGTGTCGATCATCGGTATGCGTGAGC
ACATTTTCACGGGTAACGCGTCGTCGCTTGCGAAGTTCAAGACGTGGCAAGAGCTGGTTTTCGTGACGCTATCTCAGCGTGTGTTGGCGGACCCTCTGTA
CGTGCGCATGCACTACGGTCACCCCGATGTGTTTGACAAGGTGATTGCGCTCACCCGCGGTGGTGTGTCGAAGGCGAGCAAGGGTATCAACCTGTCAGAA
GATGTGTTTGCTGGTTTCAACTCGACGCTTCGTGGCGGTGTGGTGACGCATGTGGAGTTCATGCAGTGCGGAAAGGGTCGTGATGTGGCTCTCTCCCAGA
TTTCGATGTTCGAGGGCAAGTTGGCAAACGGCGCTGGTGAAACCTCGCTCGCGCGTGAAGCGCACCGCATGGGCCAGTTCATGGACTTCTTCCGTCTCAA
CTCGATGTACTACTCGCACACGGGCTTCTACTTTGCGACGTGGATGACGATCGTGACCACTTTTGTGTACATGTACAGTAAGGTGTACATGGCGCTCGCG
GGTGTGCAGGAGCAGGTGATCTACAAGATGGAGTCCCAGGACATTATCAACTTGAACGACAACTTTGACTTTGTCGACCGCGCGTACCACGACTCCGATG
CGGTCATCAACACACAGTACTACATCCAAGCCGGTCTCTTCCTCTCGCTGCCTCTCATCGCCGTGTACTTCGGTGAGATGGGTATCCGCCGCGGTCTTGT
GCAGTTGATTGAGATGATCATCACTGGTGGACCAGCGTTCTTCATCTTCCAGGTCGGCACGACGATGCACTACTTCGACAACAACTTGCTGCACGGTGAG
GCGCAGTATAAGGCGACGGGTCGTGGATTCAAGATTACGCGTGAGACATTTGTGCTGCTGTACAAGGCATACGCGAACAGTCACTACCGCAAAGCGTTCG
AGCTCATTGGGCTTTGTCTGGTGTACCTGACGTTCGGTTCGTTCAACATCTGTAAGCGCGATGGCCCAGTGACGGAGAGTTTGTCGAGCGACTTCTGTGA
GACTTCGCAGGGCTTCGGCGTGCAGACGTTTGCGATCTGGGTGATTTCCGTTCTGTGGCTGATGTCGCCATACATTTTCAACACGGACGGTCTCGATTGG
GAGAAGACGAAGGCGGATGTCAAGGCGTGGACGGTGTGGATGTACGCGGACGAGTCATTCAAGGACGAAGATCTTCCGATGAATGGCGGCTGGATCAGCT
GGTGGAAGGGCGAGCTCAGTCTCTACCACAACACCAAGCCGATCGCTCGTTTCACCGTGCTTCTGCGCGAGAGTCGTCACTTCTTGCTGATGTGGTACGT
CATCACGTTGCGCTGGAACGCGCTCGCGGTGGCGTTGGTGTTCGGCGCGGTGATTTCTACCGTGCTGATTCTTGGCGTCATTGGCGCAGCGGGAACTGCC
ATGAAGGGAACACCTGCTCCTGTGCGCGCGGGTTTGTACCTGGCTAGTATCACCGCGTGCCTGGTCGCGTACTTTGTGATTGCGCGCGTTGTGTTGGACG
CCTCGATGGACTCGTCGCTGTCGCTTTTCTTCGGCTACATGGGCGGTCTCTACGGCTTGAACGAGATGATTCGCATGTGGAGCTTCAAGAACTCGTCGAT
CGCGTCGGTTGGCATGTTCCAGCAGCTCGCGTTCCTGTTCGACTTTGTGTTCTGCACGGCGATGATCATCCCTCTGTTCATCATGTCGGGCATCCCGTTC
CTGAACATTATCCAAACGCGTATGATGTACAACAAGGGTTTCTCGGAGGTCGTGTCGGCGTCGTCGCAATACGCGTTCTCGTTGGCTGCGTTCATGGGCA
TTCTCGGTGGCACTGGTTGCGGCTGGATCTTCCACTTGTTCACGACCCTCGAGTCGACTCCTGGCTTCATCAGCTACGTCACAACGTACGAGCTTCTGGA
CGGCAAGGCAGGCGACGGCACCACGACGTACGTGTTCTACTTCGCGTGTGTCGGTGGTACTATGATTGCTGGCATTACGAATTTCTTCATCGGACGTCGC
CTGTCGATTATCTGCGGTGGTGTGCTGGCGATGCTCGGCATGGTCTCGGTGAGCGCAGTGCAGACTTCGGGTGAGAACTTTTTGTTCCCTGGCGTGGGTC
TACTTGGCTGCGCCGTGGGCTTGTTGTTGCCAACGCTCGCGATGTATATTTACGAGATTGCGACGCGCGACATGCGCGGCAAGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTCTACTCGGCTTGGGTTTCGTTCTGGGTGTGCTCGCGTGCGCGTGGTTCTCGTCGTCGACGAACTCGGTGGGCTGGGTGTGGC
AGGTGTTCGTGGCGACGGTGATCCTGTCGATCGTGACGCCAGCCGTGTACATCTTCCCGGAGAGTCCGTACTGGGTGTACCTGCGTGAAGGCCTCGAAGC
GTGCGAGCGCTGCCTGGCGGTGCTTCGCCGCAAGGAGGGCGTATCGGAGGAGCTCAAGATGATCCGTGAGGAAGAGGCTGGTGGCGATTCGCGCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCTGCTGACGGTGCTGGCACGGTGTTCAAGTTCCTGCTAAGCCTCTTTTTGATGCTCGTGTCGGGTCT
GTTCCTGGGAGCGCTGAACATGTACATGTCGCAGAAGTTTAGCTCAATCGAGAACGCGCAGTACATGTTTGTGAACTGCGTGTCGCTGCAGTTCCTCGGT
GCGCTCTTTTCGTTCTTCTTCATGGACCGCGTGGACCACCGCCGCATCCTGTTCTGTACGCTGATCCCGATCGCGGCGCTCGTGGCGATCCTAGGCGTGA
ACGTGAACACGGGCACGTGGAAGGACGACGCTGAGTACCTGATGCTGCGCATCGTGGGTCTGCTACTGTACTTCTTCGCGGGTCTGGGCATCACGTCGGT
GCTGTGGGTGTCGTGCGTGGGCTTTTTCCGCACGAGCCAGCGCGCGTTCTACACGAACCTGTTCTTCATGGTGTTCTTCTTGGTGCCAGTTCTGTCGCTC
TTTATTCGCGTGAGCACGAGCTATGCGGACAAGCAGTACATTTACCTGTACGCGCTGTCGGGCTGCTGCGTGGTCGTGCTGCTGCTGCTCTTCGGCGTCG
GCACGCAGAAGAATGGCATGCTATGCACCAAGGCTGAGATGGAGGCCGAGCGCGCGCGCATCCGCCGCACGCGCCAGACGAGACGTAGCGCTCGCACTCC
TGGAAGCGCTCGCAGCCGCAACTTGAGCCGCTCGCGCGGCAAGTCGCACTCGAACTACCAGGTGTACGAGTCGCCCGCCGGCGGGATGCC