Description :
From Genome Similarity Track
Location :
Scaffold_1255:626- 4027
Sequence
3401 bases(100 bases per row)
TCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACAAGACAAGTTTGATGATGGTT
CCCAAGTTGTATCTTTATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCATGCTCGTCGTCAGTGGTGTTCCGTCGTCGAGGATGGCCTC
GACTTCATATTCACCGGCAACTTGATCCGGTTCCCAGCTGTCCTCAGGCAACATTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACC
AACTGAGTGCTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGCTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCAGCTCCCAATCTCGAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTCCATCTCTTCTGAAGCTTCTAGAGGGTCTGCCGAGTGTTCG
TTTCCACTTGGTTGAGGAGCAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCTCGTCGCTCCTTTTCTACAGCCTGATAATCTTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTGCGTCAGACTGCTTGCCGAGCCCTTGTTTGAGTGATGACGACATTGC
CCGCAGCGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTCTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTTCTCC
GCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTG
GCCGGTAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCTGGGTCGCGGTCGTGCCTTATTAAT
GATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTAA
ACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAG
TACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACCCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCG
ATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCA
TCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATAA
CACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATACTAAACCACTTCTGC
TCCTCGTCTTGTGCCACCTGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGT
GAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGTTC
ATCTGCAAACCTGACTCGTTTCTTGGCTTTCGTCTGTCGCCGGGTCATCACTGCTATATTACCATAATCGCACTTTGGTAAGCTGTAATCAACCACGAAA
TTTTCGAAAGTTTTCCACATTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCT
CGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACTCGACTGACCTTCGATTCCAGCGCTTCAGTGGC
TAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTGTGAGTATTCAGCAGCGCTAGC
AAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAG
CCTTGACACCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCT
CCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCACTGATCCGTCAAAAGACATGCCGAATCCGCTGTAATTACGGGAAAGCCTG
GCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTCGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGC
TTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCC
GAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGC
AGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCTTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCGTCAT
GTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGA
AACACTCGTCTTCAATCTTTCGAAGGAGCGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAG
ACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGCCG
CAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCT
G