Description :
From Genome Similarity Track
Location :
Scaffold_90:626- 2553
Sequence
1927 bases(100 bases per row)
CACACTTCTGCACACTCCTGAAGAGACCTCTCCAGTGAAAATGATCGCGGATCCGCTGGTACGCCCGATCCCCTGGTGTCCACCTTCAAGAGTGGAGTGA
TAGTGATGCAACATAGCTTGATGCAGCGTCTCCGGTGCCACCAGTCTCATCAGTCCATCACGATCTGCCTCCGATCGTTTGGAGGGTGGGCAATAGAACA
GCAGATTATCACCGTCGATCTCATAGTCCGATGCGATGTTGCCACAGGATCGAGCCTCCTCGTGTGCCAGATCAGCCACATCTCCCATCAGGTACTTCTT
CATACCCGCGATCCACGTCTCTTCATCCTGTGCTCGACAAATCCGATCGATCCGCAACTCTCGCACGAACTCCTCCTGCATGGCAGCCGGGTTCAGCCGT
GATCTGGCGCCCGATCGGGTGGTCATCGGCGATAGTCGGACGATCGACTCATCCGATCGAACGACCAGGATCTCATCAAGTCGGTTCAGTGTCACTAGAT
CCCCATGATCGGCATCATCCTCGACGACGACGCCCCCTTCACGTTGGAGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAGTCTCGTTTCACATG
TAACAGCTCGTGATCTGGCCAGTTCCGTAGTTGATCCAGCACCTTCTGCTTCAGCAATGTCAGCTTAGGTGCTTTGCAGTCGATCTCGCCCCGTACTTGT
CGGATCACCAGGTTGGAATCACCGCAGACCACTAACCTGCCTCGATCTATGCCGTCAAGGAGGTCGAGACCCAACAACAGACCGTGATACTCCGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GCCAGCACTTCTTTCTCCACCACGTTG