Description :
From Genome Similarity Track
Location :
Scaffold_1287:626- 2044
Sequence
1418 bases(100 bases per row)
CCGAGTTGACCGAGCCCACTCTCTTTCTTTTAGTGGACTTGGTTGAACGGCGAATTCGCGAATGAACAGACAACAACNNNNNNNNNNNNNNNNNNNNNNN
NNCGGCAACACACACACACGCAAACCCCAAACCACTTGGCCCAAAAACGCCCAGTCTCTCGTGCACGCCATCCCCGTTTGCCTCCCGCTCCACCAGTTTG
GGCTTTTCTTTTTGCATACTGACACGTGGGAGTACTGAGATAAGAGCGAGGGGAGAGAAAGGGGGAAAGCAAGAGAAAGCGAATGAGTGGTGAGAGCGAT
GGGACGCGAGCAGGACGGGGACAGCTGGTGAGGACATTCCGCCAATCAGCACGAAGGAAACCCAAAGAGCAGATGCCCCATCTGTTTGGCTAATCACACA
ATGCAGCGTTTTGGCCGCTTTATAACCCTACATCCGGCGTTCATTGACACCTACCCGCAGCACAGAAACCACACTGATTCGGACATAGCATGTCCCAGCA
GCATGACTCGAAGTACAGGTCAAAGATATTTCCCATGAATTCTTGCATACAATCGTCCCCATATTTACAAGACATTGTTACAAAATGCAAATCAAACACT
TTATACCTTACGCCACATCATTATTATCTTAACAGCAAAATACTTACTATGCAAGCCTAACAGGTAACAGCAGCAGAACATGATGTCAAAGAGGATTCAT
CAACGTCGTAGTCACTTCTGTATTACGTGACTTGCTAATCTTCAGGCTTGACGTATGGGCACATCTTGTTGGTTTATCCAGTCCGGATGTCCATAGTCAC
CAGCAGGTTGAGCCAAAAATATTGGTGCCAGTATGTCGCACCCCGATTTGGCGCGTGGTGATTGGTAGCAGGCTGCGGCGGAGGATTTGTAGAAAAGGCA
GGTCTTGGAAAGCCCACACATGTCTACAAAGAGACTGGCCAACCTACTCCGAAGCGAGCGCAAGAGAAAGGGCGCGTGCAGGTGACAAGAAGGAAACTTG
CCAAGCGCCAACTGGATGTTCGTTGCGCACATGCACGCCTAGCAAACAAGGACCATCAATTGATTAGCTGGCCATTACCTACGGATTTGTCAAGTCTTTT
CTCTTTTTTCTATGATGGCAAAAATTGACTTCACTACCATCAGCCACCAATCAATCAAGTAAATTGAACTCTTTGCAAAACTGTAGTGTACTACGACGTA
CACAACTTGACTTTGCTAGCCATTTGCCTCGCCGAATTTGACAGTATTGACTCGCCCACATGCAACGTTATGATAATGTTAGTGCTGTGGCCTGCCTCTG
ACACATTTTGTTGCTAATTCGTAACGATGCGAGTCGTAAAGTTGTGCGCCGCAAGAGAGTGTCGTTTGTGTCAAACCGTCATTGACCAACGACGGATGAG
GCCGACAAGCAAAGATAC