Description :
From Genome Similarity Track
Location :
Scaffold_642:626- 1661
Sequence
1035 bases(100 bases per row)
ACGGTTGCCGGAAACTATGTAGAATATGTGCTCCGTCGATTTGTAGCGAGTGAAGCTATAAGACATGATCTTGAACCTGGATTCATTTCCGATATCTTCC
GTGCGCTCAATTGGATCTTATGGCAAAGACGACAAGATACGATGGCATATCGACCACACGCGAACGGAATGGCAGAGCGTATGGTGAAAACACTGACCCG
GTCACTCAAGATGTACGTCGCTGATGTCAGCCAGCCAGACTGGGACGAGTACGCGGAGCGCCTCACTTTTGCAATAAGCAAAGATCAAGATCGGATTCGA
GGAGAGAAAACTTCTTATATGATCCATGGGTGGGATCCGCGATCTACGCTGGAAGCTACGTTAGCGGTGGGAAACACAGAAGCGAGAGATCACGATCCGA
AAAGAGGGTGATGTCTTGTACAAAGGCGATATTAGCGAGCTCAAGCAGAATCGAATGATCTATTGGAAGCCGCAATTCGAGGACGAGCGCATTGACAAAA
TCAATATCTAGACCAGCATGAGATCGAAGTAGGGTCTCAGGTGTGGTTGTATCTGGATCGGTTCTAAGAAGGGTATGCGAGAATGTTGGCACATATGTGG
CATGGGCCCTTGCGGGTGGCGGGAATGTGCGTGCGATCACGCAGTACGACTAAAGATTGCTCGCACCTCCTATCGGCTGTTTCCGATCATGCATCTGTCG
AACCTGAAACGGTTAAGGATTTTTATAGAACGGCCGAGCGACGAGCTGGTGTTTAGAAGGGGAGATCGTTACAACTTCAACGAAGCATTACCTCCAGAAG
ACAGCTGGGAAGGCGATCTCGATGAGGGCAAGTTTGAGGTGGAGAATGTGTTGGATGTACGATCTGGACGGAAAACTCGTTATGGGCGGGTACATCGTCA
GTTCCTGGTAAAATGGAAATGAGAACCCAAACCGAGTTGGGCGGACGAGCCTGACCTGATCTGTGGGGCTCTCTTGCATGAGTTTGAATGAGATCAAGTA
CGTCGAAACCGTTCCAGAACGATACAATTGCACGA