Description :
From Genome Similarity Track
Location :
Scaffold_121:62580- 65231
Sequence
2651 bases(100 bases per row)
CGGGACAGTGTGCGCATGTTTGCTGAACTACCCGAAGACGCCAAAATTCTACCCGACGTACAACAATGCCGCTTCTTCAAGTGAGCTATGCCCCGCGACT
GGCAAGATAAGCTGGCGGCATCCGGGATTCAGTACGACCACCTAAACGAGCTCAACCTGTACTTCTCACGCCTTGAGAAGAATGGAAAATCACGCACCCA
CGAGAAAAGTGCACGACACGGTACTTCACACAGTCATCGTGACCAAAGAAAGGAGCCATATAAGTCCCAACCAAGAGACGACAAACGCAAAGACCGTGGC
TTTAACCAAGCCAAGCAAGAAAGCTGGTGCAATTTCCACAAGACTGTGCACAATACCGCAGACTGTTACGCCTTGAAAAACAAAAACAAGGGTGAGCACA
AACGGTCAGAGGTGAAACTTGCCACACAACAACAAAACAAAGACAACCACGAATCCACCAAGCTCTGGAGTCGGACTCAGACGACGACGACGAAAAACCA
TACCCACGTATCCATCGTGCTATGGAGTCAGTCTCCGACGACGATGGCGATTCTTCAAGCGACGAAGATGAAGTTAAGTTTGTTGATCTTGTCGACAAGA
AGACTCAACCAACTAGCGATCCACTCCGTATAACCGTCAAGCTACGCCGAGGGGGCCACAATCTCGAGGCCTTGCTTGACAGCGGGGACGAATAACATAA
TCTACGGTGAGACGCTCGCCGCCAATCTCCAGATGAGAAAGACTCGGATTGAGCGATACAGGTCTCAATCTTGGGATTCGCTTCAGGCAAATCCTTTATA
TAAGGATATGATAGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTTTCTAAGGATTAAGGCACTCGACATGAAATCGAGCTCAAACCGGGT
TCGAAGTACTGTGTCATGAAGCAGTGGCAACTGCCTCGTGAACAAGTACTTGAGATCGACAAGTTCTTTGCCAATCGCTTAGCTGCGGGTCATGTGAATG
AGTCAACTTCCCCTCACAGCTCTCCAGCCTTCTATGTGCGCAAGGCTACTGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTAAATGCTGCAACGGT
ACCGGCTCAGACGCCGATACCAAGGAAGGATGTCATTACAGATAGTATGGCTAAGAGTACCATCTTTTCATCCATGGATCTCATGGATGGGTTCTATCAG
ATCCTAATGTGTGAACGAGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATTCTCTGGGAGTGGTTAGTAATGCCACAAGGGCTTAGCAAAGCCC
CTGCCATATTCAACAGATGTGTAACGAATCTGTTAAGATCCGTAAGAGGTTTCGCGCCCAGTTACTTCGATGATGTGTTCGTCCATAGCCGGGCTATGGA
TGGACAGACGGATGTGGAAGTGCACCGACTCCACGTCCGGAAAGTTCTTACAATGATGCGCAAGCATAAGCTGTATGCTAACCTCAAGAAGTGTATATTC
GCTGCTAGCGAAATACTACTTCTTGAGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCGGAAAAGATCAAGGCGATCACCGACTGGTCTGTGCCAG
TTTCGAAGTTAATAGACTAAGAAAGTTTTTTGGTCTGGCGGCGTACTTACACAAGTACTCGCAGAACTACGCTGAGATGACTGTTCATCTCTCTCGTCTC
TTATAAAAGAACGAGAAATTTTCATGGAACGCTGATTGTCAGTGTTCCTTTGAATGTATCAAGCAGAGCTTGATGAAATCTACCATCTTGTTTATTGCAG
ACCAAGACAGATCATTCCATGTGGTCTGTGACGCCAGTGATTTTGCAATCGGCTGCGTGTTAATGCAGTACGATACAGACGGCGCAGAGCGCGTCGTCTG
TTATCAATCGCGTCAGCTGCAAGCAGCTAAGAGTAATTATACAGTGCATGACAAGGAACAGGCAGGAGCGAACGGGGCTGAAAAAGTACGTGGCGCTGGC
CACGGGTCATTCAAGCAGCACGAAAGAAAGACGGAGGCACTCAAGAAGACGCTGGGACAGCACATGGCCGACGCGGTGCGCGCGGACGCCGAGCTGGAGC
TGCTGGAGAGACGGTCGAGTACGCTCGTGGGAGAGTGGAAACGCCGCTCGTCGTTTTCCATGACCTCGAGACGGAGCGCACGACAGAGTAGCAGCAGCAG
TAGTAATGGCTACTGTGGGGTTGTTGTGGGCCAGCCGGAAGGCGAGTTCTACTTCGCAATGATAGGAAGAGCCGACATCGAAGAATCAAAAAGCAACGTC
GCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTAAAATTCTAAAGAACTAAAGGATCGATAGGCCACG
CTTTCACGGTTTGTATTCATACTGAAAATCAAAATCAAGTGAGCTTTTACCCTTTTGTTCTACATGAGATTTCTGTTCTCATTGAGCTCACCTTCCGGCA
AAAATTTGTGTACATACCCTCGAGCACAACCAGGTTGTCTGCATCCCTCTTTTGATACTTTTGAAAAGTGGACTACTAACCGTTGCGCTATCACGATACC
ATTGGTCGACAAAGACTTCAGGAACAGTTTAGAATTGATTCGCTGGAGTGC