Description :
From Genome Similarity Track
Location :
Scaffold_24:62571- 66749
Transcript NameFunction/comments
Phyke_g1567hypothetical protein PHYSODRAFT_345098
Phyke_g1568DEAD/DEAH box RNA helicase, putative

Sequence
4178 bases(100 bases per row)
CGACTGCACGACGGCCGTGTCCATTGCCGTACTAAGAGCCCATACACCTTGATTGCGAACTTATGGTAAAAGTCAGAGTCCCACGGCCGTGGAGATGAGG
TCCATGTAGCCGTCGTTTTCGTGCAAGTCGAAGTGAAGCTGAATACAAAAACCAAATGTCTACGGCTGATTTTGACTTGATTAAAGTAAGATATGATTGT
GGAGATTTCTTGACTTGACTAAAGTAAGCAACCCGTTTAATTCATTCAGCAAAGCTGTTAGATTGTATTAAATACTACGTTTCAGTAAACACGTTAATGG
CAGAAACAACGGCACTATTAACTTAGACGAAAGTAATACTGTAATGCCTATATGATAACGCCTTGTGACGAAAACAATGGCCTACCAATCGCCAACCAAC
AGTCAAAATAGTCAACCGAATAATGGCGCTTGGGAAGGCCCCGGCGGCGTCCACGCGCAGCACGCGTGCTGTGAAGGAGCGGCAACTAGCGCTCGTGGAG
GATCCTGGACGTGACCTGCAGAGCGTGGGTGGGCGAGACATCCAGGTGGACGACGATTGGGGTGAGAAACTTAATTTACAAGTCAAAATCATGTACGTTT
AAGCCATTCCAGTTGTGCTTTTATCTAAATGGCAGCTTTTTGTCATCGTTTTGTTTAACGGTGATAATTTGTGCAACTCGTTTAAAGGAATGTGGTGGGA
ACTGTTGACCTAAAGACGCCGTTGGACCTGAAGACAATAGCTCTGCATGCGCGTAATGCTGAGTACAACCCGAAGGTAACGTTACATGTATTTTGCTAAA
GTAAAAAGCAACTTTCACTAACGGGATGAACATCTTTTGTGGTAACTTTTTTGCAGCGTTTTTCGGCGGTGATCATGCGTCTGAGAGACCCCAAGACAAC
AGCACTGATCTTTGGCTCAGGAAAAGTACGGTTACTGGTCTCAGTTGCATTTATCGAAAACGATTACCTAaatttgttgctgtgttgctAAACGTTTGTG
CGTAAACAGATTGTCATTACGGGTGGCACCAGCGAGGACAGTTGCCGGTTAGCGGCTCGCAAGTTCACGCGTGTAATACAGGTATGTGTTGCACCCCACG
TTTTAACACAACTTTCTCATTAATTATCTAACCGTATAttgttgcttttgttttAGAAACTGAACTTCCCCGCCAAGTTCTCCGAATTCAAAGTGCGCAA
TGTAATGGGCACGTGCGATATCCGCTTCCCCATTCGTCTGGAAGGACTTCTGAATGACCATGCACGTTTTTCCAGTGTACGTCTTCCTGTGTCTAACCCA
TTCATCCCACTTTCATTGTCCTAACTGCGACGAGGCATTTGTGTCTCTTGCCTCCTTTTTAGTACGAGCCTGAGCTGTTCCCTGGACTAATCTACAAGCT
AGTGGAGCCCAAACTGACGCTTTTGATTTTCGTGTCCGGCAAAATTGTCCTCTGTGGGGCTCGAGATTCGGACCACCTCCACCAAGCCATCGATAAGATG
TACCCTGTGCTACTGCAGTACCGGAAGATGACAGCTCCGCCGTCACTTGTTACAGGGAAACCTGGTTATGAGGAAAACGAGGAGCTCGAGCGGTTGGAGC
CCAGTGCCAACGTTTAAACCAAAAAGAGGCAGTGTATTGCTGTATGTATATATCCTATCCAACTAATCAAAAGAAAAACACAACAAAAAGTGATGAATGT
CTCCATCCAACGTGGTCATGAATCTCTAAAACATGTTTGCATCGTTGCTTCTTGTGATGTAGACACTTCTGTTAGGCTTATTCAGCCTTTGggttcttct
tgtgtttcttcCGCTTCTCATTGCCACCAGCCTTCGCAGCGCTCTCCTTTTTCGCTGGCTGAAACTCGTCGGTTTGATGGACAGATTCGCTGCTCTTTTT
AGGCTTCGactgcttcatctgcttcaggCGGCTCGCCTTCTTGAGGTCATATCCAGAGACCGTGTTAATCCGATGCCGCATGGGCGGGGCCTTCAGAAGC
TCCTTGCGCTTCGATACACTGTTGTGCAATAGGAACAAAAAGTTAGTCGGATGTCGCCTGCGATATCAAGAGAAGTACAAGTATGTATGCGTGTGTACCT
AGCCTTCTTGAGCGACAGCATCCAGTTGGGGACCTCGCAGCCCGAGATTTTCATCACGTTGGCAATAGTACGAAGGTACACCATATCATCCTCCGTGAAG
AACGTGACGGCTTTACCCTTGCGTCCATTTCGACCAGTACGGCCAATGCGGTGAATGTAGCTCACAGCGCTCTGTCAAAGCCAAAAATGTACAAGTGTGA
GCCTTTACCAAACTCCCATATAAACCAAAAGAGTCCTACCTGGGGGAAGTCGTAGTTGATGACCATGTTGACAGCCTTGAAGTCCATACCACGACTCATG
AGGTCTGTGCAAATGAGCACCcaaacttctccagtgcGGAAGCGGCGAATCACATCGTCACGCTGCTCCTTTGTACGGTCTGCGTGGACGGCACCAATGT
TCACTCCGTCGTAAAGCAGCTCATGGTACAATTCGTTAGCACGCTCCTTGTTTTGCACAAACAGTAGTGCCGGGAGCTGGAGACCATCATGTAACAGCTG
CTTCATGGCAACGAGCTTGCCTTTCTCCTTGCCCACGAACACGAGTTTCTGCTCAATGGTGGTAGCACCAGCATTCTTTGTGCCCACAGCAACCTTAACG
GGGTCACGCAGCACCGTCTGAGCTAGTTCTTCTACTCCCTCCAGCATCGTAGCACTGAACATGGCTCGCTGGACCTTAGCATGTGTACACGCGGCAAAAA
TCTCGTCCACCTGCTCCACGAATCCCAGCTCCAGGAGTCTGTCAGCTTCGTCGAGACATACCATCTCCACAGTGGATAAGTCCACCTTAGCTTCTTGGAT
TAGGTGCACTAGACGCAACGGCGTCGCAATCAAGACATCGTGGTTCACTGCCACCTTGCTCTTGGTCTGTGAGGTgatggtagcagcagtggcttTGGAC
AGCAAAGTGatgtgcagcttcttgcctGTAGCGAGACGCGTGAACTCGGCGCGAATCTGCACCGCCAAGTCTCGCGTAGGTGCCAAAATGATCGAGCGGA
TGCCGGTGCTAGTTCCAGTACCCACTGCCAAATTAGCCAGGATTGGAATCGCAAAAGCTGCGGTTTTACCAGAACCTGTAGGTGCTGTCGCCAACACGTC
ACGTCTATCCAGCAAACTTGGAATGGACTGCATTTGCACTGAGGTAGGCTCCTTGTACTCCGAGCGCTCAATATTCTGCAGGAGCAcacgcttcatctgc
tgcgCGCTGGTGCTTGTGTCCATGCGCATATCCGCAAATGCAGTAATCGGTGCAGGCACACTCACACCACTCACACGAATCCCAAGCTGGCgtcgcagca
actgcacACTATTCctacaacaccaacaaaaGGTACAAGTTAGAATAAAAAAGTATCCACACTTCTATAAGCAATGCAACACGTACTGTTCAACAGTCGA
GGAACttttcttggcagccttcttcgccttcttcgtcttctttACTTCATTATCGccatcctcttcgtcttcgtctttATCGTTCGTCTTGAACAGACTC
acaatctcttcttcttcttcttcttcctcgctgtcaCTAGACTCAtcagcctcctcttcagacTGTTGCGACACTGGTTCACTTCCCATTGACTCCGTCC
GTGACCGGCGACGAGCGTTCTTCTCTTTACGCTTGGTAGTTTTGGTCTTGGATGCTATTGGGGCCAGTAATTGCGACGCCTGATGCCgcgcctcgtcctc
cagACGCTGCTCCTCCAAGGCACCTTCGCTCAGCTTGCGTTTACGGCGTGGTTTGCTGCCTTTAGGCTTGCGAGGTTTGCTCTTGGGCTCATTTCCAGCC
CAGTCCGGCACCATGTCCACGCTGATCTTGCGAGGCTTGGGGAGCTTCTCCCGAGGCTTCGGAGCCTCATTGAAGCCGAAAAAATCCAGCTCATCCACCT
CCGCAGTCTTTtgcttctctttcttggCTCCAGGAGCTAAAATTTGCAGCGTAAAGCAGATATTTAGAGGGAATTTTGTTAGTGAGCGGACGTGATGTTC
TGAAGCATGTAGTGAGCGCTACATAGGCAATTGACGAGTAAAAGTTGCATGATGAGAGAGAGCATACACTTACCAAGA