Description :
From Genome Similarity Track
Location :
scaffold_12:625415- 626805
Transcript NameFunction/comments
Plaha_PHALS_13300hypothetical protein

Sequence
1390 bases(100 bases per row)
AACATATTGCTTGTCCCCATGTGACAGCTCAAACTCATGAGGTAATCATCGGATCTCTCCTAGCACGCCGTGATGTCACTACACCTCTTTTTTTAAGGAT
TCTTATGGTTCTAAAGGAGAGCCGCTCCAGTTCTCGCCGTGTGTGCCATTACCAGTGTCAGTAATAACGAAATATCCGTGACGAATTCCTCTTCAACAAC
TAACAGGGTCAACTCAGTGGTCTTACCGTTTTGAAATTATATAACATATCTCAGCGTATATCCCCACAATGTCAGCGAAAGCCCCTGCCAAAAAACTGTG
AATTCGACAAAAACTATTCACGACTCCACTACTACACCCTTTGACAGCGAATAGACTTACCCATCACATATCTCTGATCCGTACGGTTTTGCTGAATCGG
GGATGATGTGACATCGTGACGAGAAAGAATCATTCTCGATGGCACCATAAATAAAATTTTCCATTCTTGGTTTACAGTCGCCTCCTTATTTGAAGTTTTG
CTAGGAAGACTGGGACACAAAGTCAACCATACTCATGATCGAGGGATCAAACTTTCGACACCGAAATAGCAACGATAATTTCACATTGACCTATGCTTGT
CTCATTTTTTAACTGCCGGTCGCTCTATTGCTGATATCGATCTAGGTTATACCTTGGATTAAATTTGATCGCGAAGTAAGAACAGGGATAATAGGGGGTA
TATCGCTGTCACAGCTTTCAATTACTAAAGGGATTCAATAGAACCTTCAGCATGTTTCCGTCTAAAAATGATCGAATTTATTTGGTATCCCAAATGCCTT
CGCGTGTTGTCCAATGCTACCTTGAGCCGCGCTTTGCACCTGATTACTCAATACTCTTAATTTATCTCGCCTTTTCCGTGATTTGACCTTGACTTTAACT
TCAAACACGTCTAGGCtgtgagtgtaacgggggtaCATGTGCCCTTGAaggaaagggcgggtcgcacaagattgtgcgaccgtacatagctTGTATTACA
CCGTTAGTGTGatcagtggtgtggctataccctaacaagaagccatcatgtggtaggattgccagtagtaatgcatattaattagtttttactatattat
taGGTATTGCAATATTAATCAGGTGTTACTACATAAATCTaaaaaacctagggttttagatattggcggttctgccgcaactaagaCAATTGAATACAAT
CTCGATTTTGTGCAGATGTGTTCGTTTAGCTTGGTTATGGTTTTTAGTACTTCGAAGTAGTGAATTGTGATTCGCTACACAATACtcctttaaggtcggt
gaccttagctaagcttcttttaagcaaagagctacggcagccccgctgcacttagtgGCACTCGTATTCAatatacacctgagtcgttac