Description :
From Genome Similarity Track
Location :
scaffold_8:625399- 638007
Transcript NameFunction/comments
g7765.t1 hypothetical protein PHYSODRAFT_509099
g7766.t1hypothetical protein

Sequence
12608 bases(100 bases per row)
ACAACGTCGAGGCGCTGCTGGCCAGACACAACAAGAAGTTCAAGGCCATGCACACGTACGAGCCCCCGCGGCACTCGGTCCGGGAAGTGAAGCAGGTGAG
ATATGAGTTTTTAGTACTTGTTGGAGACTTTTTACTGACATTATTTTTTAGTGGGAACGCGAGATGAAAAGGTCTTATTATGCTTTGTCGGCCGAGGAGA
GGGTGCAGGCAAACCAGGAGATTGCAGTCTGGAAGAAGCGACGAGTGGGGACGACCCACTAGAGAAGTTGGAGACGACAATTGTAAAGTTAGTTGATTTT
TATCTCGTCTCACATTGTTGTTGACTAGGTGTCTAGCATACAGAGCATTGCACAGCCACGGCGGATCCAGTGGTCGGGGCTTTTGTCTGTGGGAACGTCA
AGAGCGACGACAAAGTTGGTGGAGTGGCCTGTGGTGGAGAGTGTGCCGGCGCGGATGGAGGTCTTGTACAGCGGGCACTCGTACACGTCCGACGGCTTGT
ACTCTTCTCGTCGCATGGGCTTGAGCCAGATAACAGGCATGCGATCGAAGAGCTCGTTCGGGATGGACTCGGCCATCATTCGCGTGTTGCGGTCATAGCG
CGCACCTTCCATGAAGAGCCCGAAGATGTACACGCCGAAAGGCGGCGCAGCTTTGTACTTCTCTTTGTCCTGTGCCATGATCTCGCACGAGACAACGAGC
GCGTCAATGGCGATTTTCTTGTCTCGAGAGAATGACTGCTTGACGGCTGTCATGAAGCCCTGTGGAAAGAAAAAGCCTGACAGCCAGAAACTCAACGGCG
GCCCTTGCACGAGCCAGTCGTTGGTCAACGTGATTCGTATGACGAAGTCTTCTATCCAAGAGGCCAACGGCTTCAGGCACGGATATCCAGCATTCTCCCA
CTCGCTTGGAATTTGCTGGATCAAAAACCCGTTGTACATTTTCTCGAGCGGACCAGACATGACCACCAGCCCCTTGATCGCACGCTTGAGCATCTCAAGT
GTCGTTTTCATGACTTGAATCAGCACATTGAAGCGGATCATCTCCTGCGACAGGAACACGCCCAGTGAGTTACGACTACCGCCTGCTGCTTCTTGGAAGG
TCGATGGGTGCGCCTTGCTCTCCATGAACGCATCGGGCATGCGTTCTTGGATCGCTAGCACCATCTCCATAACAATGCTGTCATTACTCTGCGCGGCACC
GCCGCCGCCGCTATCGCCACCTCCACCCAGCATCTTCAATATCGTGCCCAGCAGCTGACCAGTTTCCTTTTGCTGGAATGTGATGTCTGCGTTGGCGTGA
AGACCGAAGATGTCAGGGGCATCTGCTGTAGGCAGTGAGCTCACGTACTCGCGGACAGTAACCAGAGAGCCTTCGACTGGCGCATAGTAGAGTCCCGAGG
TGGTGAACTTGTACGAGTCGTCCATGACTCCTTTGCAGAAGAGCTTGCGCATGATACTCGAGTTCGTTCGCTTGTCCCAGCGGTCCGTTATGCGACCACC
GTAGGAAATGTCCGCTACCATGACGTTCAGCGTCAGGTACGGCACCTCTTCCTGTTCCTCCAGATACAGCCGCACCTGCTGCATTCCTGTCTTTAAGTCG
CTGTTCATCCACTCGTACGGGATGTTCCAGCCAACAGCACCAAACTTGCGTCGCTCAAGACACACAGCGTTGTAGAAGGCTAGCGCGAATAGCAGCTTCT
TGAACTCACGCGGCTTCGTGCAGCCTTCGAAATCGGCCTCTTTCATGTCAAGGAACGTACGTCCTAGGTTTGCCTTGATACCCTTCGGAGGCTCATTCGT
GATCTTGATTCCATTCTGCAGGATAGGCACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGAT
TGCTCCAAGATCTGCTCAAGCCGTCCTAGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAG
CTTCAGCAATCGGGCCTTGGCCTTGCCCAAGCGAGATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGAT
ATCGGCGCCCGGTGAAAGTACGAAGATCAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCTCCAAGATCGAACGGTGGAGACTCGGTGAAGAATTTG
CCCAGCTCACGTCCGACGAACTCGCGCGTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATT
CCCAGGGTTCCGGTAGTGCTTCGGCATGCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGT
AAATGCCGGAGAAGTATCCTTCATACCAACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCT
TGAACGGCTGAACTTCTCTTATCGCCCATCAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACG
CGTAAATTATCTTGTCTTTCTCGAACAGCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAAACGTTCTTCCAGCAC
TTCGGACTTGGTCGAGTTTTGAAGCCGCATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATT
GCGAAGTAGATAATCGATCCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATACGAGTCT
TAATCGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTACCCTTGGAGTTCTCAAGCATGTACAGAATCTT
GTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCGTTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACGTCC
ACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTAATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCTTTG
TGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAGCAC
GGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTTTGC
GATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTGTACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGCGCC
CCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCGCTG
GAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCAAGG
TACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCTCGC
CCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAGTGT
TCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCCTTA
AGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATACTGC
TCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTTGTC
CAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCGTTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTTCATTGTGACACCCACAAGTCTC
GGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATATGCGGGCATAGCTTCATCCAAGT
CCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGTTGCTGTTTGTCAGCTTCTGC
CTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTGAGCTCTTCAAGTTGCCTACG
ACTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACGCAGCATATCCACGTACAGTC
GAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCAACACTGCGGTGAATTGTCAC
GGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGAGTTAAGAGCGTCTTCTGGC
CATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATAGGAGAAAATGCCAATACCA
CATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATGGACGAACGAGACCCACAAT
TTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTCATGAACGATTTGAGCATCC
GAAAACAGGAAAACGACAGGCTGGTTTTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGCCATATCCACGAGTAATTT
CGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAGTAGAGCATTACCGCGAGG
CTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTGATGTTGTACTCTTCGAGA
TACTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCATACAAAATATTCTCGAAGC
GCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTACCAGACGATCACGGAA
AACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTGGAATACTTTGGAAAGA
TCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCTCACAATAGGTGCTG
CCATGTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGATTGGGGATCCAAAC
CATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTTCACATTTTTAAAG
AACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGCGCCGGCATATTCA
AATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCTCGTTTAGGTTGCG
AGGCTTGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAGATTTGCCAACA
CCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCACCACCATCGTGA
AATACGACGCTCCGGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGTACACATTAGT
CACGGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATGTTTGCTCCG
ACAGACCACGTAACAGCAAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACAGGATGCCA
GGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACATGAGTCTC
AATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCCAAGGATGTCAATCCTACG
TGCACTTGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGGGGCA
GTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAAAAT
GACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTGAAC
TCACCATACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGTAGA
GTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTCGTG
AACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGTAGCCCATAGTCGACAAAA
GGCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTACTGTCTCGCATAGCTCGGA
TGAGAAGCAGATCCTCGAGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTGATC
TTGCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCCGAGAAAAGCACGATCTCG
GCAATTAAACGGTAGTCCGGCACCATCATAGCAACGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCATTG
TAATGAAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTACCTG
CTGAGCAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCCATA
ATCTTGTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCTGTTTTGCCTGTACCGGCTG
GTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGGTGAATTGCC
AAGATATTCATATCCGTAGATGAAGCGCGTGTTGGTTTGTCTAGCCACAAAGTTCTTCACGTCATCCTCCCAATAGTACCGCAGCTGTCGAGTCCACTCA
AAGTCACTCAGCGAAGATACGTTACTATCAGACAATGAGCGTACTACATCTCGAGCGTGCACATCAATAGTGATGACAGCACCCATGAGAATGCGTTGCA
GTTTCGTCAGTGGCCCACGCACAAGCTGCACCATACCATCAATCTGCTTCAAGCTGAATTGTAGGAACTCGCCAACAGCTTGCGGATCGCTGCCGCTCTC
AACTTGTGCGATGGCTTCCGTGACATTTCGCGTCCAAAAGACCTGATCAACGAGAATGATCATCTGCGCTGAATATCCGAATAGCCAATCTTTGCGATCA
ATAGCATCTTCGATGGGGTAGTTCATAAGCGCCTTGACACCGTCCTCATACAGACTTGCGCGCATCGCTTTCTCCACCTCAGTAAGCCAAGCTTCCACGG
GACCCTTTGCTATAACCTGATTAGGGAACACAACGAGCTCACCTTCACCGCTCACCATGGCGTTTACAACGTTACTAGCTGAACCGGGCGTATCATCGAA
GCGCACACTCTTCATAGCGTCGAAACATTTGCCTAAGTGCGGCTGAACTGCGCGTGGATCACGGGTCTGTGACAGGATTTCCAGCAGCTCGTCATTTGAT
AGGAAGTAAAATCGTGGGAATGCCATGCGTTTGGTTTCGAGATAGTCCTCTAGGGACTTTTGAATCTCTTCAAGCAACTTGTTCGACATACGGAACTGAT
CCAAGAGCTCAGATCCACCTTCCACCGATCTAATCACACTGGGGTCGTTCTTTGTTCGTAGCATAGTCGACTTCCAGTTTTTGTCAACGAGTGCGAACTT
TTGGGCCTCCACAGGAAGTTGCTTTTGAATGTCTTCGGCGCAGAAAATGGTCTCCAAATACATCCAACTGCGCTGGCAAGCGATCCACTCATCCAGTGTG
TCCGATAGGAGCGACAGCCGCTTGCCCCAGCGCTCCACTTCATCTTTCACGCCCATGATAAACCGTGACCCCATCATTGTTTGAAGACCCACTTGATTAT
CTTCAAGCAGCATTAGAATATCTTCAAGACTTCCAAGGATGAACACGTCGTTTTGGTCGCGGTGGCTTACGCAAGTGAACTCCATTTGCTCCCACCCATG
CTTAATCTTGAGCAGTGATGCCTCAATCTGGGCCTCGCCGGAAGCTGCTGCCGACATTTCACCAACAAGGTCTTTCATGTCTAGCACGTCATACGCTACG
AGGTTTTCGAGTGTAAACAAAATACCAGGATACCAAGGCTGCCGCAGTGCCTTGAAGATTTTCTCCCAGTGACGATCTTTCATTGCTGGGTTGCCCAGTT
CAAGAACGGTAGGCATCTTCAGCTTGAATTCAGCCGTGCGGTCCTTGAGCACGGCAGTAACATCGTTGCTCAATTTCTTGTGCAATGCGTAGGCATCCTT
AAATGCTACAGCGACATCCTTTGAAAGCTCCTCCGCATTCACTTCTACGAACGGGCTAGTCATGGCACCCAAGTACAGCTCGTTCCACTTTTCAACTGCC
GTCCAAAGTGAGTCGACTGTGGCAAAGTACTCTTGTGTTGCCTGCAGGTTCAGGTACTTAAATGGCGTAAGATTAAACAGCGACTGATACTCTGTATACT
GCTTCGAGAGTTCATCCAGCTGAGTGAGCCGCTGCTTCACACTTTCCAGTTCATTCTTAACCACTGATGGATCCTCGAAGTGAGTTGCATCAATGAAAAG
TCCACCTTGCAGCTGGTTGTGCAACTGAAGTACTTGCTCGTCGAGGCGCTGAATATTAGCGTCCAACTGCTGAGTCATCTCACCCAAACGACTCGTTACG
AAAGCCTCAACAGCCTCAGTCTCTTCCTTATAGCTCTCTTGTACACCACGTAGGTCATCTAACTGCACCATGTCTTCTGATGAGATGCGTACGCCGTAGG
TACCCAGAAGACGGTACAGCTCGTCTACCACATTCGTGTTTTTTGCGAGCGCTTTCTGCTTTGACTTCAAAGTTTGCACACGCTCCACATGCCCGGCAAA
CTCTTTCAAGTGTTGTGGACGCTGTAGCAGGGACTGAATGCGCTGCTTGTACTCACCCAGCTGAGTTTTACATCGTGCACGCGCCAAGTCTTTCACTAAA
CCCTTCATAGCATCCAACTTAGCTGTCGTCATGGGGATTAATGTCTGTTTCAGTTTCCTGCTCTCCACGTGTAGAATGCCGATAGTCTGACCAGCTCGCA
TTTTTTCGAGCTCCTTCTCCCACGTGCTAATTTGTAGCATGTCTGCCTTGAGCGTGGTGACCGTGTGGGCACGTTGTGAATACTCCTCCAGGTCCCAAAC
CTTGTCGTACTCGTAGATAGGCCGCACGTTGTCAAAGATTTTCACATATTCAGATGCCTCGGCATAATCGCTTGCGATCTTGGCAACAAGTTCCTTACGG
ATCTGCCCGAACGCGACGCTGCTCGTAATGGTAGAGCCCACGTGCGGCGCGTCCGCAACAACGTTTCCCACATAGGCAGCAAATGGTCGGAGGTATAGCA
CACGCGAGACTGAATTCACGGTGCTCACGATATCATCCGTCATAGCTATTACTATGTGCTGAATTTGTTCACTTGTTGGGGCAAAAATGGTGGACTGCTC
TCCGAAAAATAATGTCGTCTCAAAGAGTCCTGTCTTACGGGGAACTTTGTTCAGCTCGCAAAGAAAGTTGGCGCAGCTCTGCACAGCCAGAATCACAAGA
CTCTCAACAGCGATGCAGTCAATAAGACGGATGAAGTCCGCAATCATGCCTGCCTCCTCAGCGGCTCGGCGAAAGAGTCTCCGTCGTCGTTGTTGCTCCG
CCTTGACAGCTACAATCGACTTGGTCTTTTCCTGACTGGTTCCCATTGCCCCCAGTGACATATCGGACATAAAATCCTCTTGTGGGTTTGACGATTTCGT
CAAATTTTTCACATCGGAGCAGACACGCTGAATGATCGACTGCAATTTCTCAATGCATACCTCAAACTGCTTCGAGCCTTCAGCACGTTTAGTGCCCTGG
TACTCCACAAAAGCCGAGCTTTCGTACGTCTTTTGAGCGCGCAGATCCAGCAAAACAACACCCATCAGCTCAGTGCTCATCACCTTCTTTACCTGTAGCA
AAGGAACACAAAAGCTTTCCTTCGCCAAAAACAATTTCGTGCTCAGCCGCTTGCGTTGGCGGCAGTAAAGCTTATAGCGCACGTTGGCACACCAAAGTGA
AAACGCCTTGTTTACGAGGTAGTGCTTAAAGAAGCGTAACGACGTAAGCACGTTGAACATCGTAGACTGACGCATCCACTCCGCCAACGCAATGAACTCG
GAGGGACTGCCAGTGCTAACGTGCACAAGTCCGCTAGACGACATCGTAAAGTGCTCATTCGGAGTCACGTCGTCCTGTGCAACGACCACAAGATCATACG
GTCGGAACGTTAACCCAGTTTCCGCGCGATTCAAATGCACAAACTTGATCTCGCTATCCGATCCATTGCGCGCAAAGAAGGCGATAGTATCCTCGCCTGT
CTTAAGAAAAGCTGTCGCTGATGCTGCCGCCGCTTCAGCAGCTGCGTCTGCTACGATCACGCTAGACGTCCCAGTTACCGGATCATGATGGCCTATGAAC
TCTGACGGACGCCGATCCCGCTGGTTGATAGCAGCCTTTTCTTCATCTTCTTCGCCTCCTTGCTCGCCATACGACCGAGCAAGTGTAGTGCGGAGGAAAC
GCCGTGGCGAAGCCTCCCGCTTCGGTCGTCCAACCTCGCCTTCCCACGAAACTCCAGTTGGCGCAGGAAACGCATCGCTCGCTGCTTTAGCCCCAGGTGA
AGCCACTTGCGCCTCTTTTGCTGCGTGTCCAGGTGGAGGTTTGGCTCGATGCGGCTTGTGCTTGCGTTCCGGGCTATGCAGCGTCCCCGGAAACACTAGG
ATCTTCTTTGGCGACGTGTATTCCTCTGCAGTAGTGAACGTGAACTTCTGGCTCGCAGCCGAATCCACTCCCACCGTCATGGGCGACTTCATTGCTGCCC
GTGCTCCAGGCACCGCCTTCATGGGTGTGTTGGACGGCAACGTGGCTCCGAATCCCGACCCACCATCAAACTCGAACGTCGCGTCCAGCGTCAGGTCATA
AATCGAGT