Description :
From Genome Similarity Track
Location :
Scaffold_92:62539- 64456
Transcript NameFunction/comments
Phyci_236299Hypothetical protein

Sequence
1917 bases(100 bases per row)
acatatctaagccattcaactgtaaaaggtcgcaaaattcgcccattaacgaaatcatgatatcgcggtatgtcatctactgtgatttggcggttacata
ccatagactagtgaattgaacgcttataaattcaagaaaggtacacaatatttaatagaggagggtatattaatactattagggctaaaaggtaatgttg
tccagattttcgagtagttcgtccgcgaagtcttcaccgtcggagttcttgtcgcgagTGTGGtagtctgggaatctacatcttgagcgttttattgagc
gtgacggcatgatCAAACTCCAggaaatgacagatttgggcactattccgtaaaagtttccaaattgtgcgccaaatgacaTGTCATTTACGGAATAATG
CCCGAATCTGTCATTCCCCTCAAACTCCAACAAATCATCAACTGTGCAGTTTGAGTTTGGTAAAAATGGCGAAAATGCGCcccttttagcaggggtattc
gtacgttgctttgcaaaacactataaagggcgaaaactgcgccctttcgtcgcgaaagggttaaAAAGTTCCCGTCGtaacggatagcaccaaatatcgt
acccttcccgaattgaacacatctcaaatctgatagaaattgttgagtatacaaagctattgtacctgcaccaatttgtatacctcaACAAGCTTCAGCA
AAGAACAAATATTAGGACAAAACCGATACTGACTTAATTTCAGAATATTTTTGTATAGTTTTGGTACTTTGTCCTAAAATTCGAAAATATATAAGTTTGC
CCTTTTATTTTGCTTTTTAGGGGCAACAATCTCCATTaaacagcttgtaaagacgtatacgatacgacattgtgagtcgctctgcaacaccaccagggct
ttccccgtggtttgaggactgatccagcagtcgccacgacgtctatgCTCGTATGCGTACACAATTCGGCGTTATCCGTTATATTATTTATTGAGTACAT
TCCCGACATTCGAAGCCCATGCACAGCTTTTAAGTAATCAATAACTCCCACATATGCACATCACCTGTACTACAGATCGTAAGTGTGTTTTGCGTATTGT
CAACTGCGCTTGCGTGAAGGACAACAACATAACTTTAAATCTCCCAACCACCACCTGTTGCCTCAGAAAATTGACGTTCGCCTGCCCAACTAGGATTACG
TGAAGTGAGTTCATTCGGATTCGAACCTGTGCCTATGAAGCATTAGTTGCAGCTTCAGTGTTCCCCTTTGCAGCTAGCCAATTCTCAGTCTTATAGTCAT
CGCCTTGTGGGCCCTACGAGTGCCCCTTGTTTGCTCGCTTCCTTTCAGTCATTTGCATGTGCCATGACGACGCGGCTCAAAGTCAAGCTGGGACGATGCG
ATCAACCAAAGTGATGGCAGAAGAATGTTGCGAGGCTGCGATCAGTGCTGCCAACGAGAGTCTTCATACCACAGCAGAGCCCGTTTTACTTTTTTTTGTG
GTGCCACGAAGAACGAGGTCTGGTTGCAGTGAATATGAAAGCCACCTTTGCCCGGATGCAGAGAGCTCGGAACATTCGTGGGAACCCAGCCATCGTGGAG
CAGCCTGAGGTGCCAGTGCCAGTGCCAACAGGTCCGAGAGGCAAGCGGGGCTTTATGTGGGTTTCTTCGCGCGATTTTGAGATCTACCCGTTGGTCTTTT
GCGTCTCGGTTGGCTGTGCGATTGGTGTGTTTAGCATCACTCGCCACCTAATGCTCAACCCCGATGTGAATCTGAGCCGTGACCGCCGCGAGACGCCTGC
CTGGGAGCGCTACAAGCCGGAGGAAGGAAAGAAATTCTCTCACAATCGCCACCACTTCGCAAATCTGAAGCCGAATCCGGTCAACCAGTTCCCAGCCACA
ACGCTGCACGAAGTGGT